Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU130881

Sigma-Aldrich

MISSION® esiRNA

targeting human JAK2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATTCCCTTGGGAAATCTGAGGCAGATTATCTGACCTTTCCATCTGGGGAGTATGTTGCAGAAGAAATCTGTATTGCTGCTTCTAAAGCTTGTGGTATCACACCTGTGTATCATAATATGTTTGCTTTAATGAGTGAAACAGAAAGGATCTGGTATCCACCCAACCATGTCTTCCATATAGATGAGTCAACCAGGCATAATGTACTCTACAGAATAAGATTTTACTTTCCTCGTTGGTATTGCAGTGGCAGCAACAGAGCCTATCGGCATGGAATATCTCGAGGTGCTGAAGCTCCTCTTCTTGATGACTTTGTCATGTCTTACCTCTTTGCTCAGTGGCGGCATGATTTTGTGCACGGATGGATAAAAGTACCTGTGACTCATGAAACACAGGAAGAATGTCTTGGGATGGCAGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiao-Guang Li et al.
EMBO reports, 20(6) (2019-05-16)
Intracellular tau accumulation forming neurofibrillary tangles is hallmark pathology of Alzheimer's disease (AD), but how tau accumulation induces synapse impairment is elusive. By overexpressing human full-length wild-type tau (termed hTau) to mimic tau abnormality as seen in the brain of
Li-Xue Zou et al.
Cells, tissues, organs, 208(1-2), 13-24 (2020-02-12)
The aim of this work was to determine the effect of miR-375 on chondrocyte metabolism and oxidative stress in osteoarthritis (OA) mouse models through the JAK2/STAT3 signaling pathway. Chondrocytes were divided into control, IL-1β, IL-1β + miR-375 mimic, IL-1β +
Kong Chen et al.
Acta biochimica et biophysica Sinica, 52(8), 832-841 (2020-08-14)
Interleukin-5 (IL-5) is manifested as its involvement in the process of atherosclerosis, but the mechanism is still unknown. In this study, we explored the effect of IL-5 on lipid metabolism and its underlying mechanisms in THP-1-derived macrophages. The quantitative polymerase
Xilong Wang et al.
International journal of clinical and experimental pathology, 8(5), 5017-5025 (2015-07-21)
MicroRNAs (miRNAs) have emerged as important regulators that potentially play critical roles in cancer cell biological processes. Previous studies have shown that miR-204 plays an important role in various human cancers. However, the underlying mechanisms of this microRNA in breast
Yuanyuan Zhou et al.
Journal of physiology and biochemistry, 73(2), 259-266 (2017-01-31)
The primary features of Alzheimer's disease (AD) are extracellular amyloid plaques consisting mainly of deposits of amyloid β (Aβ) peptides and intracellular neurofibrillary tangles (NFTs). Sets of evidence suggest that interleukin-5 (IL-5) is involved in the pathogenesis of AD. Herein

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico