Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU130711

Sigma-Aldrich

MISSION® esiRNA

targeting human FASN

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCTGGTCTTGAACTCCTTGGCGGAAGAGAAGCTGCAGGCCAGCGTGAGGTGCTTGGCTACGCACGGTCGCTTCCTGGAAATTGGCAAATTCGACCTTTCTCAGAACCACCCGCTCGGCATGGCTATCTTCCTGAAGAACGTGACATTCCACGGGGTCCTACTGGATGCGTTCTTCAACGAGAGCAGTGCTGACTGGCGGGAGGTGTGGGCGCTTGTGCAGGCCGGCATCCGGGATGGGGTGGTACGGCCCCTCAAGTGCACGGTGTTCCATGGGGCCCAGGTGGAGGACGCCTTCCGCTACATGGCCCAAGGGAAGCACATTGGCAAAGTCGTCGTGCAGGTGCTTGCGGAGGAGCCGGAGGCAGTGCTGAAGGGGGCCAAACCCAAGCTGATGTCGGCCATCTCCAAGACCTTCTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaokun Gang et al.
The Prostate, 79(8), 864-871 (2019-04-08)
Fatty acid synthase (FASN) is vital for maintaining lipid homeostasis in prostate cancer (PCa) cells, which have an increased rate of de novo fatty acid (FA) synthesis. Mutations in the gene encoding the tumor suppressor speckle-type POZ protein (SPOP), which
Dan Cao et al.
Liver international : official journal of the International Association for the Study of the Liver, 37(1), 80-89 (2016-06-07)
Although it is well established that fatty acids (FA) are indispensable for the proliferation and survival of cancer cells in hepatocellular carcinoma (HCC), inhibition of Fatty Acid Synthase (FASN) cannot completely repress HCC cell growth in culture. Thus, we hypothesized
Débora C Bastos et al.
The Journal of pathology, 253(3), 292-303 (2020-11-10)
Loss of the tumor suppressor gene Pten in murine prostate recapitulates human carcinogenesis and causes stromal proliferation surrounding murine prostate intraepithelial neoplasia (mPIN), which is reactive to microinvasion. In turn, invasion has been shown to be regulated in part by
Arif Khan et al.
International journal of nanomedicine, 15, 5575-5589 (2020-08-18)
The overexpression of Her-2 in 25-30% breast cancer cases and the crosstalk between Her-2 and fatty acid synthase (FASN) establishes Her-2 as a promising target for site-directed delivery. The present study aimed to develop the novel lipid base formulations to
Valeryia Mikalayeva et al.
International journal of molecular sciences, 20(6) (2019-03-21)
Both cytosolic fatty acid synthesis (FAS) and mitochondrial fatty acid oxidation (FAO) have been shown to play a role in the survival and proliferation of cancer cells. This study aimed to confirm experimentally whether FAS and FAO coexist in breast

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico