Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU121701

Sigma-Aldrich

MISSION® esiRNA

targeting human RRM2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTGTGATTTTGCTTGCCTGATGTTCAAACACCTGGTACACAAACCATCGGAGGAGAGAGTAAGAGAAATAATTATCAATGCTGTTCGGATAGAACAGGAGTTCCTCACTGAGGCCTTGCCTGTGAAGCTCATTGGGATGAATTGCACTCTAATGAAGCAATACATTGAGTTTGTGGCAGACAGACTTATGCTGGAACTGGGTTTTAGCAAGGTTTTCAGAGTAGAGAACCCATTTGACTTTATGGAGAATATTTCACTGGAAGGAAAGACTAACTTCTTTGAGAAGAGAGTAGGCGAGTATCAGAGGATGGGAGTGATGTCAAGTCCAACAGAGAATTCTTTTACCTTGGATGCTGACTTCTAAATGAACTGAAGATGTGCCCTTACTTGGCTGATTTTTTTTTTCCATCTCATAAGAAAAATCAGCTGAAGTGTTACCAACTAGCCACACCATGAA

Ensembl | human accession no.

ENSG00000171848

NCBI accession no.

NM_001034

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... RRM2(6241) , RRM2(6241)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yueting Wu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 103, 982-988 (2018-05-02)
Peripheral vascular disease (PVD) is a prevalent vascular disease that affect a large number of patients. The establishment of optimal treatments to mitigate the intimal hyperplasia (IH)-induced restenosis would help relieve the health burden of the PVD. Ribonucleotide reductase M2
S M Du
Neoplasma, 67(3), 567-575 (2020-03-04)
Long noncoding RNAs (lncRNAs) have been suggested to play vital roles in tumor initiation and progression. Recent studies have reported that the lncRNA small nucleolar RNA host gene 16 (SNHG16) is highly expressed in breast cancer tissue. In the present
Zejun Fang et al.
Oncotarget, 7(47), 78055-78068 (2016-11-02)
As the small subunit of Ribonucleotide reductase (RR), RRM2 displays a very important role in various critical cellular processes such as cell proliferation, DNA repair, and senescence, etc. Importantly, RRM2 functions like a tumor driver in most types of cancer
Wei Kang et al.
Oncology reports, 31(6), 2579-2586 (2014-04-24)
Ribonucleotide reductase M2 subunit (RRM2) is one of the two subunits of human ribonucleotide reductase which plays a critical role in tumor progression. The aim of the present study was to analyze its expression, clinical significance and biological functions in gastric
Chunshui Liu et al.
Oncology reports, 42(2), 571-580 (2019-06-25)
Imatinib‑based targeted treatment is the standard therapy for chronic myeloid leukemia (CML); however, drug resistance is an inevitable issue for imatinib‑based CML treatment. Imatinib resistance can be ascribed to Bcr‑Abl‑dependent and independent resistance. In the present study, peripheral blood samples
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico