Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU119241

Sigma-Aldrich

MISSION® esiRNA

targeting human CAMK4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTCTTCGCCTCTCACATCCAAACATTATAAAACTTAAAGAGATATTTGAAACCCCTACAGAAATCAGTCTGGTCCTAGAACTCGTCACAGGAGGAGAACTGTTTGATAGGATTGTGGAAAAGGGATATTACAGTGAGCGAGATGCTGCAGATGCCGTTAAACAAATCCTGGAGGCAGTTGCTTATCTACATGAAAATGGGATTGTCCATCGTGATCTCAAACCAGAGAATCTTCTTTATGCAACTCCAGCCCCAGATGCACCACTCAAAATCGCTGATTTTGGACTCTCTAAAATTGTGGAACATCAAGTGCTCATGAAGACAGTATGTGGAACCCCAGGGTACTGCGCACCTGAAATTCTTAGAGGTTGTGCCTATGGACCTGAGGTGGACATGTGGTCTGTAGGAATAATCACCTACATCTTACTTTGTGGATTTGAACCATTCTATGATGAAAGAGGCGATCAGTTCATGTTCAGGAGAATTCTGAATTGTGAATATTACTTTATCTCCCCCTGGTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

DanDan Shi et al.
Inflammation, 41(1), 199-212 (2017-10-04)
The objective of this study is to investigate the role of Calmodulin-dependent protein kinase IV (CaMKIV) in Cardiotoxin (CTX)-induced mice muscle inflammation. CTX injection i.m. was performed to induce B6 mice acute tibialis anterior (TA) muscle injury. The mice were
Kunihiro Ichinose et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(4), 944-952 (2015-12-05)
Kidney podocytes and their slit diaphragms prevent urinary protein loss. T cells from patients with systemic lupus erythematosus display increased expression of calcium/calmodulin-dependent protein kinase IV (CaMKIV). The present study was undertaken to investigate the role of CaMKIV in podocyte
Kayaho Maeda et al.
The Journal of clinical investigation, 128(8), 3445-3459 (2018-07-10)
Podocyte malfunction occurs in autoimmune and nonautoimmune kidney disease. Calcium signaling is essential for podocyte injury, but the role of Ca2+/calmodulin-dependent kinase (CaMK) signaling in podocytes has not been fully explored. We report that podocytes from patients with lupus nephritis
Xueyuan Zhou et al.
Immunology, 143(2), 287-299 (2014-04-30)
Prostaglandin E2 (PGE2 ) is an important inducer of inflammation, which is also closely linked to the progress of tumours. In macrophages, PGE2 production is regulated by arachidonic acid release and cyclooxygenase-2 (COX-2) expression. In the present study, we found

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico