Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU115801

Sigma-Aldrich

MISSION® esiRNA

targeting human GSTM1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCTCCCAAGACCTGTGTTCTCAAAGATGGCTGTCTGGGGCAACAAGTAGGGCCTTGAAGGCCAGGAGGTGGGAGTGAGGAGCCCATACTCAGCCTGCTGCCCAGGCTGTGCAGCGCAGCTGGACTCTGCATCCCAGCACCTGCCTCCTCGTTCCTTTCTCCTGTTTATTCCCATCTTTACTCCCAAGACTTCATTGTCCCTCTTCACTCCCCCTAAACCCCTGTCCCATGCAGGCCCTTTGAAGCCTCAGCTACCCACTATCCTTCGTGAACATCCCCTCCCATCATTACCCTTCCCTGCACTAAAGCCAGCCTGACCTTCCTTCCTGTTAGTGGTTGTGTCTGCTTTAAAGGGCCTGCCTGGCCCCTCGCCTGTGGAGCTCAGCCCCGAGCTGTCCCCGTGTTGCATGAAGGAGCAGCATTGACTGGT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pritha Bhattacharjee et al.
Scientific reports, 3, 2704-2704 (2013-09-21)
The gene for glutathione-S-transferase (GST) M1 (GSTM1), a member of the GST-superfamily, is widely studied in cancer risk with regard to the homozygous deletion of the gene (GSTM1 null), leading to a lack of corresponding enzymatic activity. Many of these
Yi Lu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 120, 109532-109532 (2019-10-13)
Reactive oxygen species (ROS) are implicated in carcinogenesis, and cellular antioxidant systems are important for detoxifying ROS and reversing oxidant-mediated modifications. Glutathione S-transferase mu (GSTM) belongs to a family of phase II detoxification enzymes that catalyze the conjugation of reduced
Weidong Wu et al.
Particle and fibre toxicology, 9, 31-31 (2012-08-08)
Diesel exhaust particles (DEP) contribute substantially to ambient particulate matter (PM) air pollution in urban areas. Inhalation of PM has been associated with increased incidence of lung disease in susceptible populations. We have demonstrated that the glutathione S-transferase M1 (GSTM1)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico