Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU115601

Sigma-Aldrich

MISSION® esiRNA

targeting human KRT19

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCAACGAGAAGCTAACCATGCAGAACCTCAACGACCGCCTGGCCTCCTACCTGGACAAGGTGCGCGCCCTGGAGGCGGCCAACGGCGAGCTAGAGGTGAAGATCCGCGACTGGTACCAGAAGCAGGGGCCTGGGCCCTCCCGCGACTACAGCCACTACTACACGACCATCCAGGACCTGCGGGACAAGATTCTTGGTGCCACCATTGAGAACTCCAGGATTGTCCTGCAGATCGACAATGCCCGTCTGGCTGCAGATGACTTCCGAACCAAGTTTGAGACGGAACAGGCTCTGCGCATGAGCGTGGAGGCCGACATCAACGGCCTGCGCAGGGTGCTGGATGAGCTGACCCTGGCCAGGACCGACCTGGAGATGCAGATCGAAGGCCTGAAGGAAGAGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Masato Takano et al.
BMC cancer, 16(1), 903-903 (2016-11-20)
Keratin (K) 19-positive hepatocellular carcinoma (HCC) is well known to have a higher malignant potential than K19-negative HCC: However, the molecular mechanisms involved in K19-mediated progression of HCC remain unclear. We attempted to clarify whether K19 directly affects cell survival
Takayuki Kawai et al.
Cancer medicine, 6(11), 2531-2540 (2017-10-02)
The current lack of an easily measurable surrogate marker of cancer stem cells (CSCs) prevents the clinical application of CSCs for hepatocellular carcinoma (HCC). We previously reported that keratin 19 (K19) is a novel HCC-CSC marker associated with transforming growth
Tomoaki Ohtsuka et al.
Scientific reports, 6, 39557-39557 (2016-12-23)
HER2 is a receptor tyrosine kinase and its upregulation via activating mutations or amplification has been identified in some malignant tumors, including lung cancers. Because HER2 can be a therapeutic target in HER2-driven malignancies, it is important to understand the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico