Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU113621

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2C

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGACTGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACCGACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACAAACTCAGACATCGTGGAGACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGATGCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAAGATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAGATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGCTCACT

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mingliang Bai et al.
EMBO reports, 21(11), e50283-e50283 (2020-10-06)
A microdeletion within human chromosome 5q14.3 has been associated with the occurrence of neurodevelopmental disorders, such as autism and intellectual disability, and MEF2C haploinsufficiency was identified as main cause. Here, we report that a brain-enriched long non-coding RNA, NDIME, is located
Aleksandra Deczkowska et al.
Nature communications, 8(1), 717-717 (2017-09-30)
During ageing, microglia acquire a phenotype that may negatively affect brain function. Here we show that ageing microglial phenotype is largely imposed by interferon type I (IFN-I) chronically present in aged brain milieu. Overexpression of IFN-β in the CNS of
Hong-Ping Chen et al.
Journal of cellular physiology, 234(12), 23315-23325 (2019-05-30)
MicroRNAs (miRNAs) is a small molecule (19-25 nucleotide) noncoding RNA that inhibits the expression of target messenger RNA (mRNA) at the posttranscriptional level as an endogenous regulator. There is an increasing evidence that miR-199a-3p has a significant effect on the
Jing-Jing Zhang et al.
Molecular cancer, 13, 130-130 (2014-06-03)
Increasing evidence indicates an important role of transcription factor Yin Yang-1 (YY1) in human tumorigenesis. However, its function in cancer remains controversial and the relevance of YY1 to pancreatic ductal adenocarcinoma (PDAC) remains to be clarified. In this study, we
Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico