Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU107711

Sigma-Aldrich

MISSION® esiRNA

targeting human SNW1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGATCCAGACCTGCAAAGGCCCGATGAAGAAGCTATTAAAGAGATAACAGAAAAGACAAGAGTAGCCTTAGAAAAATCTGTATCACAGAAGGTCGCCGCAGCCATGCCAGTTCGAGCAGCTGACAAATTGGCTCCTGCTCAGTATATCCGATACACACCATCTCAGCAAGGAGTGGCATTCAACTCTGGAGCTAAACAGAGGGTTATTCGGATGGTAGAAATGCAGAAAGATCCAATGGAGCCTCCAAGGTTCAAGATTAATAAGAAAATTCCCCGGGGACCACCTTCTCCTCCTGCGCCTGTCATGCATTCTCCTAGCCGAAAGATGACTGTAAAGGAACAACAAGAGTGGAAGATTCCTCCTTGTATTTCTAACTGGAAAAATGCAAAGGGTTATACAATTCCATTAGACAAACGTCTGGCTGCTGATGGAAGAGGACTACAGACAGTACACATAAATGAAAATTTCGCCAAATTGGCAGAAGCCCTCTACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Qiao Zhang et al.
Microbes and infection, 22(10), 576-584 (2020-08-18)
The Ski-interacting protein (SNW1) acts as a transcriptional co-regulator associated with mRNA splicing and transcription, cell cycle progression, acute and chronic inflammatory responses, however, its role involved in host antiviral innate immune responses remains to be explored. Here, for the
Shusen Zhang et al.
Molecular and cellular biochemistry, 410(1-2), 1-9 (2015-08-12)
SYF2, also known as p29/NTC31/CBPIN, encodes a nuclear protein that interacts with Cyclin D-type binding-protein 1. SYF2 has been reported to be involved in pre-mRNA splicing and cell cycle regulation. In the present study, we observed that SYF2 was obviously
E M Davies et al.
Oncogene, 34(28), 3711-3727 (2014-09-23)
Glioblastoma is the most common and lethal primary malignant brain tumor in adults. The tumor suppressor gene PTEN is deleted, mutated or hypermethylated in more than 60% of glioblastoma cases resulting in hyperactivation of the phosphoinositide 3-kinase pathway, which leads

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico