Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU095241

Sigma-Aldrich

MISSION® esiRNA

targeting human FGFR3 (1)

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGTGCAGGTTCCGATGTTATTAGATGTTACAAGTTTATATATATCTATATATATAATTTATTGAGTTTTTACAAGATGTATTTGTTGTAGACTTAACACTTCTTACGCAATGCTTCTAGAGTTTTATAGCCTGGACTGCTACCTTTCAAAGCTTGGAGGGAAGCCGTGAATTCAGTTGGTTCGTTCTGTACTGTTACTGGGCCCTGAGTCTGGGCAGCTGTCCCTTGCTTGCCTGCAGGGCCATGGCTCAGGGTGGTCTCTTCTTGGGGCCCAGTGCATGGTGGCCAGAGGTGTCACCCAAACCG

Ensembl | human accession no.

ENSG00000068078

NCBI accession no.

NM_000142

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... FGFR3(2261) , FGFR3(2261)

Categorías relacionadas

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Josine M Quispel-Janssen et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(1), 84-94 (2017-10-25)
Purpose: Despite intense research, treatment options for patients with mesothelioma are limited and offer only modest survival advantage. We screened a large panel of compounds in multiple mesothelioma models and correlated sensitivity with a range of molecular features to detect
Xina Xie et al.
Experimental and therapeutic medicine, 18(2), 1226-1234 (2019-07-19)
Fibroblast growth factor receptor 3 (FGFR3) is a high frequency mutant gene in bladder cancer (BCa) and has become a promising therapeutic target due to its involvement in cell proliferation and migration. However, whether and how FGFR3 mutations affects BCa
Takeshi Okada et al.
Molecular neurobiology, 56(12), 8203-8219 (2019-06-17)
Neuronal apoptosis is a common and critical pathology following subarachnoid hemorrhage (SAH). We investigated the anti-apoptotic property of fibroblast growth factor (FGF)-2 after SAH in rats. A total of 289 rats underwent endovascular perforation to induce SAH or sham operation.
Evan K Day et al.
Cell reports, 30(10), 3383-3396 (2020-03-12)
SPRY2 is a purported tumor suppressor in certain cancers that promotes tumor growth and resistance to receptor tyrosine kinase inhibitors in glioblastoma. Here, we identify a SPRY2-dependent bypass signaling mechanism in glioblastoma that drives resistance to EGFR and MET inhibition.
V Tassinari et al.
Cell death & disease, 6, e1688-e1688 (2015-03-15)
Both fibroblast growth factor 9 (Fgf9) and Kit Ligand (Kl) signal through tyrosine kinase receptors, yet they exert opposite effects on meiotic differentiation in postnatal spermatogonia, Fgf9 acting as a meiosis-inhibiting substance and Kl acting as a promoter of the
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico