Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU084971

Sigma-Aldrich

MISSION® esiRNA

targeting human ILF3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCACGCACTGCGGCTCGCTGCCTTCGGCCAGCTCCATAAAGTCCTAGGCATGGACCCTCTGCCTTCCAAGATGCCCAAGAAACCAAAGAATGAAAACCCAGTGGACTACACCGTTCAGATCCCACCAAGCACCACCTATGCCATTACGCCCATGAAACGCCCAATGGAGGAGGACGGGGAGGAGAAGTCGCCCAGCAAAAAGAAGAAGAAGATTCAGAAGAAAGAGGAGAAGGCAGAGCCCCCCCAGGCTATGAATGCCCTGATGCGGTTGAACCAGCTGAAGCCAGGGCTGCAGTACAAGCTGGTGTCCCA

Ensembl | human accession no.

ENSG00000129351

NCBI accession no.

NM_012218

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ILF3(3609) , ILF3(3609)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

M Laura Idda et al.
Nucleic acids research, 46(22), 12040-12051 (2018-10-03)
Polymorphisms in untranslated regions (UTRs) of disease-associated mRNAs can alter protein production. We recently identified a genetic variant in the 3'UTR of the TNFSF13B gene, encoding the cytokine BAFF (B-cell-activating factor), that generates an alternative polyadenylation site yielding a shorter
Tracey W Chan et al.
Genome biology, 21(1), 268-268 (2020-10-28)
RNA editing generates modifications to the RNA sequences, thereby increasing protein diversity and shaping various layers of gene regulation. Recent studies have revealed global shifts in editing levels across many cancer types, as well as a few specific mechanisms implicating
Zejin Pu et al.
Journal of cellular biochemistry, 120(10), 18172-18185 (2019-05-31)
Adenosine is a promising cytotoxic reagent for tumors, long noncoding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been indicated to play critical roles in tumorigenesis, ILF3 has been recognized as a MEG3-binding protein, however, the roles of adenosine and
Rong Jia et al.
RNA (New York, N.Y.), 25(5), 630-644 (2019-02-24)
Alternative RNA splicing is an important focus in molecular and clinical oncology. We report here that SRSF3 regulates alternative RNA splicing of interleukin enhancer binding factor 3 (ILF3) and production of this double-strand RNA-binding protein. An increased coexpression of ILF3

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico