Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU084371

Sigma-Aldrich

MISSION® esiRNA

targeting human SON

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGAGGAACACCTGAAAGGTGACTTTTACGAAAGTGAACATGGTATAAATATAGACCTTAATATAAATAATCATTTAATTGCTAAAGAGATGGAACATAATACAGTGTGTGCTGCTGGTACTAGTCCTGTTGGGGAAATTGGTGAAGAGAAAATTTTGCCCACCAGTGAGACTAAACAGCGCACAGTATTGGATACCTACCCTGGTGTTAGTGAAGCTGATGCAGGAGAAACTCTATCTTCTACTGGTCCTTTTGCTCTGGAACCTGATGCAACAGGAACTAGTAAGGGTATTGAATTTACCACAGCATCTACTCTCAGTTTAGTTAATAAATATGATGTTGATTTATCTTTAACTACTCAAGATACTGAACATGACATGGTAATTTCCACCAGTCCTAGTGGTGGTAGTGAAGCTGACATTGAAGGGCCTTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Vishnu Priya Battini et al.
International journal of molecular sciences, 16(3), 5886-5899 (2015-03-18)
Pre-mRNA splicing requires proper splice site selection mediated by many factors including snRNPs and serine-arginine rich (SR) splicing factors. Our lab previously reported that the SR-like protein SON maintains organization of pre-mRNA splicing factors in nuclear speckles as well as
Hyehyeon Lee et al.
Molecules and cells, 42(1), 67-78 (2018-12-07)
Methylation of HBV cccDNA has been detected in vivo and in vitro; however, the mechanism and its effects on HBV replication remain unclear. HBx derived from a 1.2-mer HBV replicon upregulated protein levels and enzyme activities of DNA methyltransferase 1
İbrahim Avşar Ilik et al.
eLife, 9 (2020-10-24)
Nuclear speckles (NS) are among the most prominent biomolecular condensates. Despite their prevalence, research on the function of NS is virtually restricted to colocalization analyses, since an organizing core, without which NS cannot form, remains unidentified. The monoclonal antibody SC35

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico