Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU083111

Sigma-Aldrich

MISSION® esiRNA

targeting human CD86

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATGGCTCATGACCTGGAAATAAAATTTAGGACCAATACCTCCTCCAGATCAGATTCTTCTCTTAATTTCATAGATTGTGTTTTTTTTTTAAATAGACCTCTCAATTTCTGGAAAACTGCCTTTTATCTGCCCAGAATTCTAAGCTGGTGCCCCACTGAATTTTGTGTGTACCTGTGACTAAACAACTACCTCCTCAGTCTGGGTGGGACTTATGTATTTATGACCTTATAGTGTTAATATCTTGAAACATAGAGATCTATGTACTGTAATAGTGTGATTACTATGCTCTAGAGAAAAGTCTACCCCTGCTAAGGAGTTCTCATCCCTCTGTCAGGGTCAGTAAGGAAAACGGTGGCCTAGGGTACAGGCAACAATGAGCAGACCAACCTAAATTTGGGGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Impacts of CD40- and CD86-Silenced Antigen-Specific B Cells on the Control of Allergies.
Motohiko Suzuki et al.
American journal of rhinology & allergy, 33(5), 513-523 (2019-05-09)
Emi Furusawa et al.
The Journal of investigative dermatology, 139(10), 2164-2173 (2019-04-13)
PD-L2 is a ligand for the immune checkpoint receptor PD-1; however, its regulatory function is unclear. We previously reported that silencing of CD86 in cutaneous dendritic cells by topical application of small interfering RNA (siRNA) inhibits the elicitation of contact
Naila Mebarek et al.
European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 92, 216-227 (2015-03-23)
Dendritic cells (DCs) are professional antigen-presenting cells that play a critical role in maintaining the balance between immunity and tolerance and, as such are a promising immunotherapy tool to induce immunity or to restore tolerance. The main challenge to harness

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico