Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU082601

Sigma-Aldrich

MISSION® esiRNA

targeting human EXOSC10

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAGATGCAGTGCTTCAAAAGCCACAACCCCAGTTATACAGACCTATAGAAGAGACACCATGCCATTTCATATCCTCCCTGGATGAACTCGTGGAACTCAACGAAAAGCTCTTGAATTGTCAGGAATTTGCAGTTGACTTGGAGCACCACTCTTACAGGAGCTTCCTGGGACTGACCTGCCTGATGCAAATTTCTACTCGGACGGAAGACTTCATCATTGACACCCTCGAGCTTCGAAGTGACATGTACATTCTCAATGAGAGCCTCACAGACCCAGCCATCGTTAAGGTCTTTCATGGTGCTGATTCAGACATAGAATGGCTACAGAAAGACTTTGGGTTGTATGTAGTAAACATGTTTGATACTCATCAGGCAGCACGCCTTCTTAACCTGGGCAGGCACT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Lee Davidson et al.
Cell reports, 26(10), 2779-2791 (2019-03-07)
Cell-based studies of human ribonucleases traditionally rely on methods that deplete proteins slowly. We engineered cells in which the 3'→5' exoribonucleases of the exosome complex, DIS3 and EXOSC10, can be rapidly eliminated to assess their immediate roles in nuclear RNA biology.
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component
Karla Rubio et al.
Nature communications, 10(1), 2229-2229 (2019-05-22)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and highly lethal lung disease with unknown etiology and poor prognosis. IPF patients die within 2 years after diagnosis mostly due to respiratory failure. Current treatments against IPF aim to ameliorate patient
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico