Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU081851

Sigma-Aldrich

MISSION® esiRNA

targeting human ANGPT2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATGGAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCAGCTAAGGACCCCACTGTTGCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACCACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGTGACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTTGATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATATTGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATACACCTTAAAGACTGGGAAGGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mi-Lan Kang et al.
Journal of cellular biochemistry, 118(9), 2896-2908 (2017-02-19)
Our previous studies revealed that co-transplantation of bone marrow stem cells (BMSCs) and adipose-derived stem cells (ADSCs) can enhance bone regeneration and angiogenesis. However, it is unclear which genes are involved in the regulation of osteogenesis and/or angiogenesis during the
Jing Xu et al.
American journal of physiology. Cell physiology, 313(3), C262-C273 (2017-06-24)
Angiopoietin-2 (Ang-2) contributes to vascular hyporeactivity after hemorrhagic shock and hypoxia through upregulation of inducible nitric oxide synthase (iNOS) in a vascular endothelial cell (VEC)-specific and Ang-2/Tie2 receptor-dependent manner. While iNOS is primarily expressed in vascular smooth muscle cells (VSMCs)
Don Yuen et al.
Investigative ophthalmology & visual science, 55(5), 3320-3327 (2014-05-02)
Lymphatic research has progressed rapidly in recent years. Lymphatic dysfunction has been found in myriad disorders from cancer metastasis to transplant rejection; however, effective treatment for lymphatic disorders is still limited. This study investigates the role of angiopoietin-2 (Ang-2) in
Changqing Luo et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 34(3), 916-928 (2014-09-10)
To investigate the role of angiopoietin-2 (Ang-2) and IL-18 in the pathogenesis of diabetic nephropathy (DN) and the molecular mechanisms through which alprostadil protects renal function. DN was induced by streptozotocin and intraperitoneal injection of alprostadil was given to diabetic

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico