Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU078541

Sigma-Aldrich

MISSION® esiRNA

targeting human GLS2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTGGACAAGCTGGGGAACAGCCATAGGGGGACCAGCTTCTGCCAGAAGTTGGTGTCTCTCTTCAATTTCCACAACTATGACAACCTGAGGCACTGTGCTCGGAAGTTAGACCCACGGCGTGAAGGGGCAGAAATTCGGAACAAGACTGTGGTCAACCTGTTATTTGCTGCCTATAGTGGCGATGTCTCAGCTCTTCGAAGGTTTGCCTTGTCAGCCATGGATATGGAACAGAAAGACTATGACTCGCGCACAGCTCTGCATGTTGCTGCAGCTGAAGGACACATCGAAGTTGTTAAATTCCTGATCGAGGCTTGCAAAGTGAATCCTTTTGCCAAGGACAGGTGGGGCAACATTCCCCTGGATGATGCTGTGCAGTTCAACCATCTGGAGGTGGTCAAACTGCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xulu Ye et al.
Anticancer research, 36(11), 6021-6029 (2016-10-30)
Inhibition of glutaminolysis has been reported as a promising therapeutic strategy to target several solid carcinomas. We aimed to investigate the effects of glutaminolysis on cell proliferation in lung squamous cell carcinoma cell lines and to explore the potential of
Ying Niu et al.
Life sciences, 237, 116893-116893 (2019-10-14)
Gastric cancer (GC) is a common human malignancy tumor of digestive tract in worldwide. Physcion 8-O-β-glucopyranoside (PG) exhibits anti-tumor effects in various cancer cells. This study aimed to explore the biological behavior effects of PG on GC cells, and determine
Jason D Arroyo et al.
Nucleic acids research, 42(9), 6064-6077 (2014-03-07)
Unlike short interfering RNAs (siRNAs), which are commonly designed to repress a single messenger RNA (mRNA) target through perfect base pairing, microRNAs (miRNAs) are endogenous small RNAs that have evolved to concurrently repress multiple mRNA targets through imperfect complementarity. MicroRNA

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico