Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU075051

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHA2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGACCTGATGCAGAACATCATGAATGACATGCCGATCTACATGTACTCCGTGTGCAACGTGATGTCTGGCGACCAGGACAACTGGCTCCGCACCAACTGGGTGTACCGAGGAGAGGCTGAGCGTATCTTCATTGAGCTCAAGTTTACTGTACGTGACTGCAACAGCTTCCCTGGTGGCGCCAGCTCCTGCAAGGAGACTTTCAACCTCTACTATGCCGAGTCGGACCTGGACTACGGCACCAACTTCCAGAAGCGCCTGTTCACCAAGATTGACACCATTGCGCCCGATGAGATCACCGTCAGCAGCGACTTCGAGGCACGCCACGTGAAGCTGAACGTGGAGGAGCGCTCCGTGGGGCCGCTCACCCGCAAAGGCTTCTACCTGGCCTTCCAGGATATCGGTGCCT

Ensembl | human accession no.

ENSG00000142627

NCBI accession no.

NM_004431

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... EPHA2(1969) , EPHA2(1969)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hee Sung Kim et al.
Scientific reports, 9(1), 3414-3414 (2019-03-06)
Genetically deregulated tumor cells generate vascular channels by vasculogenic mimicry (VM) that is independent of endothelial blood vessels. The morphological characteristics of VM and the role of EphA2 in the formation of VM were evaluated in 144 clinical samples of
Qiaoli Wu et al.
Biochemical and biophysical research communications, 503(4), 2436-2442 (2018-07-04)
MiR-124-3p and EphA2 are aberrantly expressed in glioma tissue specimens. In the present study, we firstly investigated that miR-124-3p inhibits EphA2 expression mediated by binding its 3'-UTR to regulate the progression of human glioma. The U87MG and LN229 cells were transfected
Xin Zhang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(4), 5495-5509 (2019-01-23)
The balance of myogenic and adipogenic differentiation is crucial for skeletal muscle homeostasis. Given the vital role of membrane proteins (MBPs) in cell signal perception, membrane proteomics was conducted to delineate mechanisms regulating differentiation of adipogenic and myogenic precursors in
Maleeha A Qazi et al.
Cancer research, 78(17), 5023-5037 (2018-06-28)
Glioblastoma (GBM) carries a dismal prognosis and inevitably relapses despite aggressive therapy. Many members of the Eph receptor tyrosine kinase (EphR) family are expressed by GBM stem cells (GSC), which have been implicated in resistance to GBM therapy. In this
Marc Swidergall et al.
PLoS pathogens, 17(1), e1009221-e1009221 (2021-01-21)
During oropharyngeal candidiasis (OPC), Candida albicans invades and damages oral epithelial cells, which respond by producing proinflammatory mediators that recruit phagocytes to foci of infection. The ephrin type-A receptor 2 (EphA2) detects β-glucan and plays a central role in stimulating
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico