Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU072211

Sigma-Aldrich

MISSION® esiRNA

targeting human DKK3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCACCCTCAATGAGATGTTCCGCGAGGTTGAGGAACTGATGGAGGACACGCAGCACAAATTGCGCAGCGCGGTGGAAGAGATGGAGGCAGAAGAAGCTGCTGCTAAAGCATCATCAGAAGTGAACCTGGCAAACTTACCTCCCAGCTATCACAATGAGACCAACACAGACACGAAGGTTGGAAATAATACCATCCATGTGCACCGAGAAATTCACAAGATAACCAACAACCAGACTGGACAAATGGTCTTTTCAGAGACAGTTATCACATCTGTGGGAGACGAAGAAGGCAGAAGGAGCCACGAGTGCATCATCGACGAGGACTGTGGGCCCAGCATGTACTGCCAGTTTGCCAGCTTCCAGTACACCTGCCAGCCATGCCGGGGCCAGAGGATGCTCTGCACCCGGGACAGTGAGTGCTGTGGAGACCAGCTGTGTGTCTGGGGTCACTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bo Liu et al.
Experimental and therapeutic medicine, 18(6), 4747-4757 (2019-11-28)
MicroRNA-1303 (miR-1303) is involved in the tumorigenesis and progression of several cancers, and yet the role of miR-1303 in prostate cancer (PCa) and its underlying mechanism are unknown. To explore this issue, the present study aimed to use PCa tissues
Gang Peng et al.
Experimental and therapeutic medicine, 18(1), 769-778 (2019-07-02)
MicroRNAs (miRs) serve important roles in glioma. However, the underlying molecular mechanism of miR-25 in glioma progression remains largely unknown; therefore, it was investigated in the present study. RT-qPCR analysis revealed that miR-25 expression levels were markedly increased in human
Zainab Al Shareef et al.
Oncogene, 37(39), 5305-5324 (2018-06-03)
Aberrant transforming growth factor-β (TGF-β) signaling is a hallmark of the stromal microenvironment in cancer. Dickkopf-3 (Dkk-3), shown to inhibit TGF-β signaling, is downregulated in prostate cancer and upregulated in the stroma in benign prostatic hyperplasia, but the function of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico