Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU071991

Sigma-Aldrich

MISSION® esiRNA

targeting human VCP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGAAGCCATCAATGAGGACAACAGTGTGGTGTCCTTGTCCCAGCCCAAGATGGATGAATTGCAGTTGTTCCGAGGTGACACAGTGTTGCTGAAAGGAAAGAAGAGACGAGAAGCTGTTTGCATCGTCCTTTCTGATGATACTTGTTCTGATGAGAAGATTCGGATGAATAGAGTTGTTCGGAATAACCTTCGTGTACGCCTAGGGGATGTCATCAGCATCCAGCCATGCCCTGATGTGAAGTACGGCAAACGTATCCATGTGCTGCCCATTGATGACACAGTGGAAGGCATTACTGGTAATCTCTTCGAGGTATACCTTAAGCCGTACTTCCTGGAAGCGTATCGACCCATCCGGAAAGGAGACATTTTTCTTGTCCGTGGTGGGATGCGTGCTGTGGAGTTCAAAGTGG

Ensembl | human accession no.

ENSG00000165280

NCBI accession no.

NM_007126

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... VCP(7415) , VCP(7415)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wallaya Phongphaew et al.
Virus research, 228, 114-123 (2016-12-05)
Valosin-containing protein (VCP) is classified as a member of the type II AAA
Katrin Schweitzer et al.
Journal of cellular and molecular medicine, 20(1), 58-70 (2015-10-16)
Cullin-RING-ubiquitin-ligase (CRL)-dependent ubiquitination of the nuclear factor kappa B (NF-κB) inhibitor IκBα and its subsequent degradation by the proteasome usually precede NF-κB/RelA nuclear activity. Through removal of the CRL-activating modification of their cullin subunit with the ubiquitin (Ub)-like modifier NEDD8
Richard Wargachuk et al.
Cellular signalling, 30, 50-58 (2016-11-27)
GPCRs form signalling complexes with other receptors as part of dimers, G proteins and effector partners. A proteomic screen to identify proteins that associate with the β
Sevil Cayli et al.
Theriogenology, 158, 196-206 (2020-09-24)
p97/valosin-containing protein (VCP) is expressed in many cells and plays critical functions in a broad range of diverse cellular processes. Because it is expressed in the mouse testes, predominantly in Sertoli cells, and is known to play a critical role
Xing Guo et al.
Biochimica et biophysica acta, 1863(2), 552-559 (2016-12-04)
Proteasome-dependent turnover of mitochondrial outer membrane (OMM)-associated proteins is one of the mechanisms for maintaining proper mitochondrial quality and function. However, the underlying pathways and their implications in human disease are poorly understood. Huntington's disease (HD) is a fatal, inherited
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico