Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU071471

Sigma-Aldrich

MISSION® esiRNA

targeting human AL513122.2, GSN, AL513122.1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCACCAACCTTTATGGAGACTTCTTCACGGGCGACGCCTACGTCATCCTGAAGACAGTGCAGCTGAGGAACGGAAATCTGCAGTATGACCTCCACTACTGGCTGGGCAATGAGTGCAGCCAGGATGAGAGCGGGGCGGCCGCCATCTTTACCGTGCAGCTGGATGACTACCTGAACGGCCGGGCCGTGCAGCACCGTGAGGTCCAGGGCTTCGAGTCGGCCACCTTCCTAGGCTACTTCAAGTCTGGCCTGAAGTACAAGAAAGGAGGTGTGGCATCAGGATTCAAGCACGTGGTACCCAACGAGGTGGTGGTGCAGAGACTCTTCCAGGTCAAAGGGCGGCGTGTGGTCCGTGCCACCGAGGTACCTGTGTCCTGGGAGAGCTTCAACAATGGCGACTGCTTCATCCTGGACCTGGGCAACAACATCCACCAGTGGTGTGGTTCCAACAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Zhi-Yuan Chen et al.
Journal of biomedical science, 22, 90-90 (2015-10-21)
Increasing evidence suggests that transforming growth factor-beta 1 (TGF-β1) triggers epithelial to mesenchymal transition (EMT) and facilitates breast cancer stem cell differentiation. Gelsolin (GSN) is a ubiquitous actin filament-severing protein. However, the relationship between the expression level of GSN and
Meshach Asare-Werehene et al.
Oncogene, 39(7), 1600-1616 (2019-11-09)
Ovarian cancer (OVCA) is the most lethal gynecological cancer, due predominantly to late presentation, high recurrence rate and common chemoresistance development. The expression of the actin-associated protein cytosolic gelsolin (GSN) regulates the gynecological cancer cell fate resulting in dysregulation in
Dylan Z Kelley et al.
Translational research : the journal of laboratory and clinical medicine, 202, 109-119 (2018-08-18)
We have recently performed the characterization of alternative splicing events (ASEs) in head and neck squamous cell carcinoma, which allows dysregulation of protein expression common for cancer cells. Such analysis demonstrated a high ASE prevalence among tumor samples, including tumor-specific

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico