Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU070981

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACCCCTCTCCTCTGTCTCCAGAAGCTTCTAGCTCTGGGGTCTGGCTACCGCTAGGAGGCTGAGCAAGCCAGGAAGGGAAGGAGTCTGTGTGGTGTGTATGTGCATGCAGCCTACACCCACACGTGTGTACCGGGGGTGAATGTGTGTGAGCATGTGTGTGTGCATGTACCGGGGAATGAAGGTGAACATACACCTCTGTGTGTGCACTGCAGACACGCCCCAGTGTGTCCACATGTGTGTGCATGAGTCCATGTGTGCGCGTGGGGGGGCTCTAACTGCACTTTCGGCCCTTTTGCTCTGGGGGTCCCACAAGGCCCAGGGCAGTGCCTGCTCCCAGAATCTGGTGCTCTGACCAGGCCAGGTGGGGAGGCTTTGGCTGGCTGGGCGTGTAGGACGGTGAGAGCACTTCT

Ensembl | human accession no.

ENSG00000101412

NCBI accession no.

NM_005225

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... E2F1(1869) , E2F1(1869)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yuan He et al.
Life sciences, 252, 117656-117656 (2020-04-15)
Diabetes is considered as one of the important risks in the progression of Hepatocellular carcinoma(HCC). Ribosome binding protein 1 (RRBP1), a rough endoplasmic reticulum protein, plays an essential role in diabetes and various cancer. E2F transcription factor 1 (E2F1), an
Lei Liu et al.
Oncology reports, 37(6), 3597-3605 (2017-05-13)
Tripartite motif containing 28 (TRIM28) is a universal corepressor for Kruppel‑associated box zinc finger proteins. In our previous study, it was shown that expression of TRIM28 is upregulated in non‑small cell lung cancer (NSCLC) cell lines and tissues. Here, we
Wen Luo et al.
Scientific reports, 6, 27904-27904 (2016-06-11)
miR-17 family microRNAs (miRNAs) are crucial for embryo development, however, their role in muscle development is still unclear. miR-20a-5p and miR-20b-5p belong to the miR-17 family and are transcribed from the miR-17~92 and miR-106a~363 clusters respectively. In this study, we
Juan Liu et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 37(2), 2673-2682 (2015-09-26)
Cancerous inhibitor of protein phosphatase 2A (CIP2A) is a recently identified oncoprotein. Here, we investigated its role in the formation of multidrug resistance (MDR) of cervical adenocarcinoma in vitro and in vivo. MTT assay showed that knockdown of CIP2A expression
Dan Zhao et al.
Frontiers in molecular neuroscience, 12, 281-281 (2019-12-24)
Intracerebral hemorrhage (ICH) is a subtype of stroke with highest mortality and morbidity. We have previously demonstrated that dipotassium bisperoxo (picolinato) oxovanadate (V), (bpV[pic]) inhibits phosphatase and tensin homolog (PTEN) and activates extracellular signal-regulated kinase (ERK)1/2. In this study, we
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico