Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU067301

Sigma-Aldrich

MISSION® esiRNA

targeting human TFCP2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ACAACCACACCTCAGGAAGCTCAGCAGTGGTTGCATCGAAATCGTTTTTCTACATTCACAAGGCTTTTCACAAACTTCTCAGGGGCAGATTTATTGAAATTAACTAGAGATGATGTGATCCAAATCTGTGGCCCTGCAGATGGAATCAGACTTTTTAATGCATTAAAAGGCCGGATGGTGCGTCCAAGGTTAACCATTTATGTTTGTCAGGAATCACTGCAGTTGAGGGAGCAGCAACAACAGCAGCAGCAACAGCAGCAGAAGCATGAGGATGGAGACTCAAATGGTACTTTCTTCGTTTACCATGCTATCTATCTAGAAGAACTAACAGCTGTTGAATTGACAGAAAAAATTGCTCAGCTTTTCAGCATTTCCCCTTGCCAGATCAGCCAGATTTACAAGCAGGGGCCAAC

Ensembl | human accession no.

ENSG00000135457

NCBI accession no.

NM_005653

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TFCP2(7024) , TFCP2(7024)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shi Wang et al.
Acta biochimica et biophysica Sinica, 48(12), 1085-1093 (2016-11-01)
Pancreatic cancer is an aggressive malignancy. The median survival rate remains low, indicating that the identification of novel biomarkers and therapeutic targets is critical. Here, we examined the role of microRNA-182 (miR-182) in pancreatic cancer development. Analysis of human pancreatic
Kedarlal Sharma et al.
Journal of molecular neuroscience : MN, 65(3), 343-350 (2018-07-12)
MeCP2 (methyl-CpG binding protein 2), an epigenetic regulator, has been shown to regulate the function of neurons and glial cells. Our previous study has demonstrated that MeCP2 repress the myelin gene expression in rat oligodendrocytes but whether MeCP2 bind to
Arpita Dave et al.
Journal of molecular neuroscience : MN, 67(1), 16-27 (2018-12-07)
Astrocytes play the central role in CNS metabolism to support neuronal functions. Mehyl-CpG-binding protein 2 (MeCP2) is the global transcription factor with differential expression in neuronal and non-neuronal cells. MeCP2 mutation and downstream detrimental effects have been reported in astrocytes
Jiawei Zhou et al.
Cell death & disease, 8(2), e2597-e2597 (2017-02-10)
Mammalian folliculogenesis is a complex process in which primordial follicles develop into pre-ovulatory follicles, followed by ovulation to release mature oocytes. In this study, we explored the role of miR-144 in ovulation. miR-144 was one of the differentially expressed microRNAs
Buch Lipi et al.
Experimental brain research, 236(11), 3015-3027 (2018-08-18)
Astrocytes perform several critical functions such as promoting neuronal maturation, neuronal survival, maintaining and supporting neurons and oligodendrocytes. Astrocytes participate in the formation of nodes of Ranvier. Recently, studies emphasizing on the role of astrocytes in regulating myelination by secreting

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico