Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU066241

Sigma-Aldrich

MISSION® esiRNA

targeting human NDRG2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGGAAAAAGGGCAGATCATGCGGGGAGATGACCTTGATCTTTGATTGCTACCCTAACCTTGACCTTTAACCCGTGATTCCCCCCAGCTCCTGGAAGAGATGTCCTAATATCTCTTAGGGACCCAGACCCCTAAATTCTCCTCCTCCCCCATTTTGATGTTAAGGTGGAGAGGGCATATGCATCCTCTGTCCTGATCTAGGTGTCTATAGCTGAGGGGTAAGAGGTTGTTGTAGTTGTCCTGGTGCCTCCATCAGACTCTCCCTACTTGTCCCATATTTGCAAGGGGAGGGGATTTGGGGCTGGGGCTCCATTCACCAAAGCTGAGGTGGCTTCTCATTAACCCTTTAGGACTCTGAAGGGTATGGACCTACGTGAATGTGTGTCAGGGGGAGACTTGCTGGTGGGTTAGTGGT

Ensembl | human accession no.

ENSG00000165795

NCBI accession no.

NM_201535

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NDRG2(57447) , NDRG2(57447)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Z H Su et al.
Neoplasma, 67(5), 1002-1011 (2020-05-27)
Renal cell carcinoma (RCC) is the most common malignant tumor of the kidney. In this study, we investigated the role of miR-346 in RCC cells under hypoxia. OS-RC-2 and 786-O cells were cultured in 1% O2 or normal oxygen. Cell
Kyeongah Kang et al.
Biochemical and biophysical research communications, 468(4), 611-616 (2015-11-08)
N-Myc downstream-regulated gene 2 (NDRG2), a member of the NDRG family of differentiation-related genes, has been characterized as a regulator of dendritic cell differentiation from monocytes, CD34(+) progenitor cells, and myelomonocytic leukemic cells. In this study, we show that NDRG2
Fenhong Kang et al.
Journal of ovarian research, 13(1), 48-48 (2020-04-30)
The cancer cell metastasis and the acquisition of chemotherapy resistance remain huge challenge for ovarian cancer treatment. Previously, N-myc downstream-regulated gene 2 (NDRG2) serves as a tumor suppressor for many cancers. Here, we attempted to investigate the specific roles of
Qiang Fu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 97, 120-127 (2017-10-29)
MicroRNA-454 (miR-454) is emerging as critical regulator in tumorigenesis; it may function as an oncogene or a tumor suppressor. However, the role of miR-454 in prostate cancer remains unknown. In this study, we aimed to investigate the function and molecular
Xinyu Deng et al.
Oncotarget, 8(24), 38294-38308 (2017-04-19)
Breast cancer (BC) is a leading cause of cancer-related death in women. Adjuvant systemic chemotherapies are effective in reducing risks of recurrence and have contributed to reduced BC mortality. Although targeted adjuvant treatments determined by biomarkers for endocrine and HER2-directed
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico