Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU064361

Sigma-Aldrich

MISSION® esiRNA

targeting human NOX4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTCCTCATGATCACAGCCTCTACATATGCAATAAGAGTTTCTAACTATGATATCTTCTGGTATACTCATAACCTCTTCTTTGTCTTCTACATGCTGCTGACGTTGCATGTTTCAGGAGGGCTGCTGAAGTATCAAACTAATTTAGATACCCACCCTCCCGGCTGCATCAGTCTTAACCGAACCAGCTCTCAGAATATTTCCTTACCAGAGTATTTCTCAGAACATTTTCATGAACCTTTCCCTGAAGGATTTTCAAAACCGGCAGAGTTTACCCAGCACAAATTTGTGAAGATTTGTATGGAAGAGCCCAGATTCCAAGCTAATTTTCCACAGACTTGGCTTTGGATTTCTGGACCTTTGTGCCTGTACTGTGCCGAAAGACTTTACAGGTATATCCGGAGCAATAAGCCAGTCACCATCATTTCGGTCATGAGTCATCCCTCAGATGTCATGGAAATCCGAATGGTCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Junwei Zhang et al.
European journal of pharmacology, 804, 1-6 (2017-04-12)
Naringin, a naturally flavanone glycoside, has been previously demonstrated to alleviate diabetic kidney disease by inhibiting oxidative stress and inflammatory reaction. However, the underlying mechanism of naringin in diabetic nephropathy (DN) has not been fully elucidated. Here, the beneficial effect
Qipeng Wu et al.
Experimental cell research, 352(2), 245-254 (2017-02-16)
The redox adaptation mechanisms in cancer cells are very complex and remain largely unclear. Our previous studies have confirmed that NADPH oxidase 4 (NOX4) is abundantly expressed in non-small cell lung cancer (NSCLC) and confers apoptosis resistance on NSCLC cells.
Weichao Guo et al.
American journal of physiology. Lung cellular and molecular physiology, 312(6), L936-L944 (2017-03-25)
Myofibroblasts are important mediators of fibrogenesis; thus blocking fibroblast-to-myofibroblast differentiation (FMD) may be an effective strategy to treat pulmonary fibrosis (PF). Previously, we reported that histone deacetylase 4 (HDAC4) activity is necessary for transforming growth factor-β
Wenwen Zhao et al.
Scientific reports, 7(1), 12953-12953 (2017-10-13)
ICAM-1 overexpression and subsequent adhesion of leukocytes to endothelial cells play critical roles in the early stage of atherosclerosis. Danshenol A (DA) is an abietane-type diterpenoid isolated from traditional Chinese herb Salvia miltiorrhiza Bunge. The mechanisms under its regulation of
Ha-Reum Lee et al.
Arthritis research & therapy, 22(1), 116-116 (2020-05-18)
Reactive oxygen species (ROS) regulate the migration and invasion of fibroblast-like synoviocytes (FLS), which are key effector cells in rheumatoid arthritis (RA) pathogenesis. Nicotinamide adenine dinucleotide phosphate oxidase 4 (NOX4) induces ROS generation and, consequently, enhances cell migration. Despite the

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico