Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU063661

Sigma-Aldrich

MISSION® esiRNA

targeting human METTL3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGCCAGCCAAGAAATCAAGGAAACATGCTGCCTCAGATGTTGATCTGGAGATAGAGAGCCTTCTGAACCAACAGTCCACTAAGGAACAACAGAGCAAGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACTACAACAGCCAAGGAACAATCCATTGTTGAAAAATTTCGCTCTCGAGGTCGGGCCCAAGTGCAAGAATTCTGTGACTATGGAACCAAGGAGGAGTGCATGAAAGCCAGTGATGCTGATCGACCCTGTCGCAAGCTGCACTTCAGACGAATTATCAATAAACACACTGATGAGTCTTTAGGTGACTGCTCTTTCCTTAATACATGTTTCCACATGGATACCTGCAAGTATGTTCACTATGAAATTGATGCTTGCATGGATTCTGAGGCCCCTGGCAGCAAAGACCACACGCCAAGCCAGGAGCTTGCTCTTACACAGAGTGTCGGAGGTGATTCCAGT

Ensembl | human accession no.

ENSG00000165819

NCBI accession no.

NM_019852

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... METTL3(56339) , METTL3(56339)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

wgk_germany

WGK 1

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tianfang Xia et al.
Pathology, research and practice, 215(11), 152666-152666 (2019-10-14)
Epigenetic modifications are involved in carcinogenesis and METTL3 is involved in RNA methylation. This study aimed to explore the role of the RNA m6A methyltransferase METTL3 in pancreatic cancer cells. The m6A modification was analyzed in human pancreatic cancer and
Jiarong Cai et al.
OncoTargets and therapy, 12, 9143-9152 (2019-12-07)
N6-methyladenosine (m6A) is the most abundant internal modification on eukaryotic mRNA and gained increasing attention recently. More and more evidence suggest that m6A methylation plays crucial role in tumor genesis and development. However, its role in prostate cancer remains largely
Shiyan Gu et al.
Toxicology letters, 292, 1-11 (2018-04-24)
N6-methyladenosine (m6A) modification is implicated to play an important role in cellular biological processes, but its regulatory mechanisms in arsenite-induced carcinogenesis are largely unknown. Here, human bronchial epithelial (HBE) cells were chronically treated with 2.5 μM arsenite sodium (NaAsO2) for about
Daniel A Lorenz et al.
RNA (New York, N.Y.), 26(1), 19-28 (2019-10-19)
Direct RNA sequencing holds great promise for the de novo identification of RNA modifications at single-coordinate resolution; however, interpretation of raw sequencing output to discover modified bases remains a challenge. Using Oxford Nanopore's direct RNA sequencing technology, we developed a
Ly P Vu et al.
Nature medicine, 23(11), 1369-1376 (2017-09-19)
N6-methyladenosine (m6A) is an abundant nucleotide modification in mRNA that is required for the differentiation of mouse embryonic stem cells. However, it remains unknown whether the m6A modification controls the differentiation of normal and/or malignant myeloid hematopoietic cells. Here we
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico