Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU062091

Sigma-Aldrich

MISSION® esiRNA

targeting human NFIA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGTTCTTTCCAACCCAGACCAGAAAGGCAAGATGCGAAGAATTGACTGCCTCCGCCAGGCAGATAAAGTCTGGAGGTTGGACCTTGTTATGGTGATTTTGTTTAAAGGTATTCCGCTGGAAAGTACTGATGGCGAGCGCCTTGTAAAGTCCCCACAATGCTCTAATCCAGGGCTCTGTGTCCAACCCCATCACATAGGGGTTTCTGTTAAGGAACTCGATTTATATTTGGCATACTTTGTGCATGCAGCAGATTCAAGTCAATCTGAAAGTCCCAGCCAGCCAAGTGACGCTGACATTAAGGACCAGCCAGAAAATGGACATTTGGGCTTCCAGGACAGTTTTGTCACATCAGGTGTTTTTAGTGTCACTGAGCTAGTAAGAGTGTCACAGACACCAATAGCTGCAGGAACTGGCCCAAATTTTTCTCTCTCAGATTTGGAAAGTTCTTCATACTACAGCATGAGTCCAGGAGCAAT

Ensembl | human accession no.

ENSG00000162599

NCBI accession no.

NM_005595

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... NFIA(4774) , NFIA(4774)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Chin-Cheng Lee et al.
PloS one, 12(3), e0173890-e0173890 (2017-03-23)
MicroRNAs are small noncoding RNAs that post-transcriptionally control the expression of genes involved in glioblastoma multiforme (GBM) development. Although miR-302b functions as a tumor suppressor, its role in GBM is still unclear. Therefore, this study comprehensively explored the roles of
Hairui Yuan et al.
Journal of cellular physiology, 236(3), 1810-1821 (2020-07-24)
miR-142a-5p plays critical roles in multiple biological processes and diseases, such as inflammation and tumorigenesis. However, it remains to be explored if and how miR-142a-5p contributes to osteoblast differentiation. In this study, our results showed that miR-142a-5p was highly expressed
Wenxiang Hu et al.
Cell stem cell, 24(2), 299-308 (2019-01-15)
Thiazolidinedione drugs (TZDs) target the transcriptional activity of peroxisome proliferator activated receptor γ (PPARγ) to reverse insulin resistance in type 2 diabetes, but side effects limit their clinical use. Here, using human adipose stem cell-derived adipocytes, we demonstrate that SNPs
Motoshi Nagao et al.
Nature communications, 7, 11102-11102 (2016-03-24)
Multipotent neural precursor cells (NPCs) generate astrocytes at late stages of mammalian neocortical development. Many signalling pathways that regulate astrocytogenesis directly induce the expression of GFAP, a marker of terminally differentiated astrocytes. However, astrocyte specification occurs before GFAP expression and

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico