Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU050501

Sigma-Aldrich

MISSION® esiRNA

targeting human SGPL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGACTGCTAAGGGGTGGAACTTGAACCAGTTGCAGTTCCCACCCAGTATTCATTTCTGCATCACATTACTACACGCCCGGAAACGAGTAGCTATACAATTCCTAAAGGACATTCGAGAATCTGTCACTCAAATCATGAAGAATCCTAAAGCGAAGACCACAGGAATGGGTGCCATCTATGGCATGGCCCAGACAACTGTTGACAGGAATATGGTTGCAGAATTGTCCTCAGTCTTCTTGGACAGCTTGTACAGCACCGACACTGTCACCCAGGGCAGCCAGATGAATGGTTCTCCAAAACCCCACTGAACTTGGACCCTTTCTAGTCTCAAGGGGATTCCAGCCTTCAGAAGGTTCTTGGGATATGGAACAGGCCGTGCACAACTTTGACATCTGGTCTTGCTCCATAGAGCACAACTCAAGATAGACCATGAGACAGCTTGAGCCTCAGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Haifei Wang et al.
Genes & genetic systems, 93(5), 191-198 (2018-11-27)
DNA methylation is an important mediator of gene expression regulation and has been shown to be closely linked to aging. Immune-related genes tend to be influenced by DNA methylation at different ages. To explore DNA methylation changes in the porcine
Yuxuan Zhen et al.
Journal of autoimmunity, 93, 37-44 (2018-06-14)
Glomerulonephritis (GN) is a typical lesion in autoantibody and immune complex disorders, including SLE. Because the Gas6/Axl pathway has been implicated in the pathogenesis of many types of GN, targeting this pathway might ameliorate GN. Consequently, we have studied the
Pan-Feng Feng et al.
Molecular pharmaceutics, 16(4), 1477-1488 (2019-02-27)
The hERG potassium channel (IKr) encoded by human ether-a-go-go-related gene plays an important role in cardiac repolarization. Decreased IKr may lead to long QT syndrome, which subsequently causes torsade de pointes and sudden cardiac death. Previous studies have shown that
Qiongying Hu et al.
Molecular medicine reports, 15(3), 1335-1342 (2017-01-19)
Osteosarcoma is the most common primary bone tumor characterized by high risk of metastasis, thus presents with an overall survival rate of 60%, despite the use of chemotherapy and surgery. Metastasis‑associated lung adenocarcinoma transcript 1 (MALAT‑1) has been reported to upregulated
Rui Yamaguchi et al.
Cytokine, 108, 24-36 (2018-03-21)
The stimuli inducing expression of single immunoglobulin IL-1-related receptor (SIGIRR) and the relevant regulatory mechanisms are not well defined. Transforming growth factor β1 (TGFβ1) delays internalization of neurokinin-1 receptor (NK1R) and subsequently enhances cellular signaling. This study investigated the effect

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico