Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU047751

Sigma-Aldrich

MISSION® esiRNA

targeting human CX3CL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCACCTTCTGCCATCTGACTGTCCTGCTGGCTGGACAGCACCACGGTGTGACGAAATGCAACATCACGTGCAGCAAGATGACATCAAAGATACCTGTAGCTTTGCTCATCCACTATCAACAGAACCAGGCATCATGCGGCAAACGCGCAATCATCTTGGAGACGAGACAGCACAGGCTGTTCTGTGCCGACCCGAAGGAGCAATGGGTCAAGGACGCGATGCAGCATCTGGACCGCCAGGCTGCTGCCCTAACTCGAAATGGCGGCACCTTCGAGAAGCAGATCGGCGAGGTGAAGCCCAGGACCACCCCTGCCGCCGGGGGAATGGACGAGTCTGTGGTCCTGGAGCCCGAAGCCACAGGCGAAAGCAGTAGCCTGGAGCCGACTCCTTCTTCCCAGGAAGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ju-Fang Liu et al.
Oncotarget, 8(33), 54136-54148 (2017-09-15)
Osteosarcoma is the most common primary bone tumor in children and teens. The exact molecular mechanism underlying osteosarcoma progression still remains unclear. The CX3CL1/fractalkine has been implicated in various tumors but not in osteosarcoma. This study is the first to
Claudia Geismann et al.
International journal of molecular sciences, 19(6) (2018-06-06)
Pancreatic ductal adenocarcinoma (PDAC) is one of the most lethal malignant neoplasms and registers rising death rates in western countries. Due to its late detection in advanced stages, its extremely aggressive nature and the minimal effectiveness of currently available therapies
Feifei Ren et al.
Immunology and cell biology, 97(5), 457-469 (2018-12-24)
Mutations in the isocitrate dehydrogenase (IDH) 1 gene, especially the R132H mutation, have been reported to be associated with a better prognosis in glioma patients. However, the underlying molecular mechanisms are not yet well understood. Many factors may contribute to
Monika Siwetz et al.
The American journal of pathology, 185(5), 1334-1343 (2015-03-15)
The pathogenesis of preeclampsia (PE) includes the release of placental factors into the maternal circulation, inducing an inflammatory environment in the mother. One of the factors may be the proinflammatory chemokine fractalkine, which is expressed in the syncytiotrophoblast of human
Monika Siwetz et al.
Histochemistry and cell biology, 143(6), 565-574 (2015-01-09)
The chemokine fractalkine (CX3CL1) recently attracted increasing attention in the field of placenta research due to its dual nature, acting both as membrane-bound and soluble forms. While the membrane-bound form mediates flow-resistant adhesion of leukocytes to endothelial and epithelial cells

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico