Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU039371

Sigma-Aldrich

MISSION® esiRNA

targeting human FSTL1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGATGGACACTGCAAAGAGAAGAAATCCGTAAGTCCATCTGCCAGCCCAGTTGTTTGCTATCAGTCCAACCGTGATGAGCTCCGACGTCGCATCATCCAGTGGCTGGAAGCTGAGATCATTCCAGATGGCTGGTTCTCTAAAGGCAGCAACTACAGTGAAATCCTAGACAAGTATTTTAAGAACTTTGATAATGGTGATTCTCGCCTGGACTCCAGTGAATTCCTGAAGTTTGTGGAACAGAATGAAACTGCCATCAATATTACAACGTATCCAGACCAGGAGAACAACAAGTTGCTTAGGGGACTCTGTGTTGATGCTCTCATTGAACTGTCTGATGAAAATGCTGATTGGAAACTCAGCTTCCAAGAGTTTCTCAAGTGCCTCAACCCATCTTTCAACCCTCCTGA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Zhang et al.
Scientific reports, 7, 45820-45820 (2017-04-01)
Pulmonary hypertension (PH) remains a life-limiting disease characterized by pulmonary vascular remodelling due to aberrant proliferation and migration of pulmonary artery smooth muscle cells (PASMCs), thus leading to raised pulmonary arterial pressure and right ventricular hypertrophy. Secreted glycoprotein follistatin-like 1
Marco Chi-Chung Lau et al.
Cancer research, 77(21), 5886-5899 (2017-09-09)
Esophageal squamous cell carcinoma (ESCC) has a generally poor prognosis, and molecular markers to improve early detection and predict outcomes are greatly needed. Here, we report that the BMP-binding follistatin-like protein FSTL1 is overexpressed in ESCCs, where it correlates with
Pei-Suen Tsou et al.
Arthritis & rheumatology (Hoboken, N.J.), 68(12), 2975-2985 (2016-08-03)
Vascular dysfunction represents a disease-initiating event in systemic sclerosis (SSc; scleroderma). Results of recent studies suggest that epigenetic dysregulation impairs normal angiogenesis and can result in abnormal patterns of blood vessel growth. Histone deacetylases (HDACs) control endothelial cell (EC) proliferation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico