Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU039341

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPC5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGACCTGGCCAAGTTGAAGGTGGCAATCAAATACCACCAGAAAGAGTTTGTTGCTCAGCCCAACTGCCAACAGTTGCTTGCCACCCTGTGGTATGATGGCTTCCCTGGATGGCGGCGGAAACACTGGGTAGTCAAGCTTCTAACCTGCATGACCATTGGGTTCCTGTTTCCCATGCTGTCTATAGCCTACCTGATCTCACCCAGGAGCAACCTTGGGCTGTTCATCAAGAAACCCTTTATCAAGTTTATCTGCCACACAGCATCCTATTTGACCTTCCTCTTTATGCTTCTCCTGGCTTCTCAGCACATTGTCAGGACAGACCTTCATGTACAGGGGCCTCCCCCAACTGTCGTGGAATGGATGATATTGCCTTGGGTTCTAGGTTTCATTTGGGGTGAGATTAAGGAAATGTGGGATGGTGGATTTACTGAATACATCCATGACTGGTGGAACCTGATGGATTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yan Zou et al.
Oncology reports, 41(6), 3413-3423 (2019-04-04)
Temozolomide (TMZ) is the first choice chemotherapy agent against glioblastoma, but the TMZ chemotherapy resistance has restricted the clinical application. Although autophagy is considered an adaptive response for cell survival under the pressure of chemotherapy and associated with chemotherapy resistance
Kayaho Maeda et al.
The Journal of clinical investigation, 128(8), 3445-3459 (2018-07-10)
Podocyte malfunction occurs in autoimmune and nonautoimmune kidney disease. Calcium signaling is essential for podocyte injury, but the role of Ca2+/calmodulin-dependent kinase (CaMK) signaling in podocytes has not been fully explored. We report that podocytes from patients with lupus nephritis
Peng Zhang et al.
Scientific reports, 7(1), 3158-3158 (2017-06-11)
Adriamycin is a first-line chemotherapy agent against cancer, but the development of resistance has become a major problem. Although autophagy is considered to be an adaptive survival response in response to chemotherapy and may be associated with chemoresistance, its inducer

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico