Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU038231

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFAIP6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCTAAGGCGGTGTGTGAATTTGAAGGCGGCCATCTCGCAACTTACAAGCAGCTAGAGGCAGCCAGAAAAATTGGATTTCATGTCTGTGCTGCTGGATGGATGGCTAAGGGCAGAGTTGGATACCCCATTGTGAAGCCAGGGCCCAACTGTGGATTTGGAAAAACTGGCATTATTGATTATGGAATCCGTCTCAATAGGAGTGAAAGATGGGATGCCTATTGCTACAACCCACACGCAAAGGAGTGTGGTGGCGTCTTTACAGATCCAAAGCAAATTTTTAAATCTCCAGGCTTCCCAAATGAGTACGAAGATAACCAAATCTGCTACTGGCACATTAGACTCAAGTATGGTCAGCGTATTCACCTGAGTTTTTTAGATTTTGACCTTGAAGATGACCCAGGTTGCTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tae-Hoon Shin et al.
Cell death & disease, 7(12), e2524-e2524 (2016-12-23)
Rheumatoid arthritis (RA) is a long-lasting intractable autoimmune disorder, which has become a substantial public health problem. Despite widespread use of biologic drugs, there have been uncertainties in efficacy and long-term safety. Mesenchymal stem cells (MSCs) have been suggested as
Guohu Di et al.
Investigative ophthalmology & visual science, 58(10), 4344–4354-4344–4354 (2017-08-16)
To explore the role and mechanism of bone marrow-derived mesenchymal stem cells (BM-MSCs) in corneal epithelial wound healing in type 1 diabetic mice. Diabetic mice were treated with subconjunctival injections of BM-MSCs or recombinant tumor necrosis factor-α-stimulated gene/protein-6 (TSG-6). The
Young In Yun et al.
Cytotherapy, 19(1), 28-35 (2016-11-15)
Mesenchymal stromal cells (MSCs) offer tremendous potential for therapeutic applications for inflammatory diseases. However, tissue-derived MSCs, such as bone marrow-derived MSCs (BM-MSCs), have considerable donor variations and limited expandability. It was recently demonstrated that MSCs derived from induced pluripotent stem
Hyun Beom Song et al.
Molecular therapy : the journal of the American Society of Gene Therapy, 26(1), 162-172 (2018-01-05)
The cornea is a transparent tissue devoid of blood and lymphatic vessels. However, various inflammatory conditions can cause hemangiogenesis and lymphangiogenesis in the cornea, compromising transparency and visual acuity. Mesenchymal stem/stromal cells (MSCs) have therapeutic potentials in a variety of
Shengchao Zhang et al.
Stem cell research & therapy, 12(1), 50-50 (2021-01-11)
Muscle stem cells (MuSCs) are absolutely required for the formation, repair, and regeneration of skeletal muscle tissue. Increasing evidence demonstrated that tissue stem cells, especially mesenchymal stem cells (MSCs), can exert therapeutic effects on various degenerative and inflammatory disorders based

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico