Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU035401

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCL16

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATGCTTACTCGGGGATTGTGGCCCACCAGAAGCATTTACTTCCTACCAGCCCCCCAATTTCTCAGGCCTCAGAGGGGGCATCTTCAGATATCCACACCCCTGCCCAGATGCTCCTGTCCACCTTGCAGTCCACTCAGCGCCCCACCCTCCCAGTAGGATCACTGTCCTCGGACAAAGAGCTCACTCGTCCCAATGAAACCACCATTCACACTGCGGGCCACAGTCTGGCAGCTGGGCCTGAGGCTGGGGAGAACCAGAAGCAGCCGGAAAAAAATGCTGGTCCCACAGCCAGGACATCAGCCACAGTGCCAGTCCTGTGCCTCCTGGCCATCATCTTCATCCTCACCGCAGCCCTTTCCTATGTGCTGTGCAAGAGGAGGAGGGGGCAGTCACCGCAGTCCTCTCCAGATCTGCCGGTTCATTATATACCTGTGGCACCTGACTCTAATACCTGAGCCAAGAATGGAAGCTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kun Ling Ma et al.
American journal of translational research, 10(6), 1802-1816 (2018-07-19)
Non-alcoholic fatty liver disease (NAFLD), characterised by early lipid accumulation and subsequent inflammation in the liver, is becoming a worldwide challenge due to its increasing prevalence in developing and developed countries. This study aimed to investigate the role of CXC
Audrey Dieudonné et al.
PloS one, 7(8), e41952-e41952 (2012-08-11)
Scavenger receptors and Toll-like receptors (TLRs) cooperate in response to danger signals to adjust the host immune response. The TLR3 agonist double stranded (ds)RNA is an efficient activator of innate signalling in bronchial epithelial cells. In this study, we aimed
Ze-Bo Hu et al.
Acta pharmacologica Sinica, 39(6), 1022-1033 (2018-04-06)
Inflammation and lipid disorders play crucial roles in synergistically accelerating the progression of diabetic nephropathy (DN). In this study we investigated how inflammation and lipid disorders caused tubulointerstitial injury in DN in vivo and in vitro. Diabetic db/db mice were

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico