Saltar al contenido
Merck
Todas las fotos(1)

Documentos

EHU031671

Sigma-Aldrich

MISSION® esiRNA

targeting human CD81

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCTGTCATGATGTTCGTTGGCTTCCTGGGCTGCTACGGGGCCATCCAGGAATCCCAGTGCCTGCTGGGGACGTTCTTCACCTGCCTGGTCATCCTGTTTGCCTGTGAGGTGGCCGCCGGCATCTGGGGCTTTGTCAACAAGGACCAGATCGCCAAGGATGTGAAGCAGTTCTATGACCAGGCCCTACAGCAGGCCGTGGTGGATGATGACGCCAACAACGCCAAGGCTGTGGTGAAGACCTTCCACGAGACGCTTGACTGCTGTGGCTCCAGCACACTGACTGCTTTGACCACCTCAGTGCTCAAGAACAATTTGTGTCCCTCGGGCAGCAACATCATCAGCAACCTCTTCAAGGAGGACTGCCACCAGAAGATCGATGACCTCTTCTCCGGGAAGCTGTACCTCATCGGCAT

Ensembl | human accession no.

ENSG00000110651

NCBI accession no.

NM_004356

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CD81(975) , CD81(975)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Down-regulation of CD81 in human cells producing HCV-E1/E2 retroVLPs.
Ana F Rodrigues et al.
BMC proceedings, 5 Suppl 8, P72-P72 (2012-03-01)
Raphaël Gaudin et al.
PloS one, 8(7), e69450-e69450 (2013-08-08)
During HIV pathogenesis, infected macrophages behave as "viral reservoirs" that accumulate and retain virions within dedicated internal Virus-Containing Compartments (VCCs). The nature of VCCs remains ill characterized and controversial. Using wild-type HIV-1 and a replication-competent HIV-1 carrying GFP internal to
Zhen-yong Keck et al.
PLoS pathogens, 8(4), e1002653-e1002653 (2012-04-19)
The majority of broadly neutralizing antibodies to hepatitis C virus (HCV) are against conformational epitopes on the E2 glycoprotein. Many of them recognize overlapping epitopes in a cluster, designated as antigenic domain B, that contains residues G530 and D535. To
Chien-Te K Tseng et al.
The Journal of experimental medicine, 195(1), 43-49 (2002-01-10)
Infection with hepatitis C virus (HCV) is a leading cause of chronic liver disease worldwide. Little is known about how this virus is able to persist or whether this persistence might be because of its ability to alter the early
Zhihui Chen et al.
PloS one, 6(4), e18933-e18933 (2011-04-29)
HCV infection is often associated with B-cell regulatory control disturbance and delayed appearance of neutralizing antibodies. CD81 is a cellular receptor for HCV and can bind to HCV envelope protein 2 (E2). CD81 also participates to form a B cell
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico