Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU024671

Sigma-Aldrich

MISSION® esiRNA

targeting human ANXA1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCTTGTATGAAGCAGGAGAAAGGAGAAAGGGGACAGACGTAAACGTGTTCAATACCATCCTTACCACCAGAAGCTATCCACAACTTCGCAGAGTGTTTCAGAAATACACCAAGTACAGTAAGCATGACATGAACAAAGTTCTGGACCTGGAGTTGAAAGGTGACATTGAGAAATGCCTCACAGCTATCGTGAAGTGCGCCACAAGCAAACCAGCTTTCTTTGCAGAGAAGCTTCATCAAGCCATGAAAGGTGTTGGAACTCGCCATAAGGCATTGATCAGGATTATGGTTTCCCGTTCTGAAATTGACATGAATGATATCAAAGCATTCTATCAGAAGATGTATGGTATCTCCCTTTGCCAAGCCATCCTGGATGAAACCAAAGGAGATTATGAGAAAATCCTGGTGGCTCTTTGTG

Ensembl | human accession no.

ENSG00000135046

NCBI accession no.

NM_000700

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ANXA1(301) , ANXA1(301)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yin Zhao et al.
Biochimica et biophysica acta, 1863(6), 1350-1358 (2017-04-09)
The degeneration of retinal ganglion cells (RGCs) has been identified as a major problem in glaucoma. Previous studies have indicated an association between annexin A1 (ANXA1) and neuronal cell apoptosis, and RGCs apoptosis in acute ischemia-reperfusion was attributed to an
Hisashi Onozawa et al.
Oncology reports, 37(1), 235-240 (2016-11-15)
Resistance to 5-fluorouracil (5‑FU), a key drug in the treatment of colorectal cancer, is one of the major reasons for poor patient prognosis during cancer treatment. Annexin A1 (ANXA1) is a calcium‑dependent phospholipid‑linked protein that is associated with drug resistance, anti‑inflammatory effects
Chandrika Senthilkumaran et al.
Veterinary research, 46, 6-6 (2015-04-02)
Annexins A1 and A2 are proteins known to function in the stress response, dampening inflammatory responses and mediating fibrinolysis. We found, in healthy cattle recently arrived to a feedlot, that lower levels of these proteins correlated with later development of
Anjana Bhardwaj et al.
PloS one, 10(5), e0127678-e0127678 (2015-05-23)
Annexin A1 (ANXA1) is an anti-inflammatory protein reported to play a role in cell proliferation and apoptosis, and to be deregulated in breast cancer. The exact role of annexin A1 in the biology of breast cancer remains unclear. We hypothesized

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico