Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU023751

Sigma-Aldrich

MISSION® esiRNA

targeting human IL1B

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGCCAATCTTCATTGCTCAAGTGTCTGAAGCAGCCATGGCAGAAGTACCTGAGCTCGCCAGTGAAATGATGGCTTATTACAGTGGCAATGAGGATGACTTGTTCTTTGAAGCTGATGGCCCTAAACAGATGAAGTGCTCCTTCCAGGACCTGGACCTCTGCCCTCTGGATGGCGGCATCCAGCTACGAATCTCCGACCACCACTACAGCAAGGGCTTCAGGCAGGCCGCGTCAGTTGTTGTGGCCATGGACAAGCTGAGGAAGATGCTGGTTCCCTGCCCACAGACCTTCCAGGAGAATGACCTGAGCACCTTCTTTCCCTTCATCTTTGAAGAAGAACCTATCTTCTTCGACACATGGGATAACGAGGCTTATGTGCACGATGCACCTGTACGATCACTGAACTGCACGCTCCGGGACTCACAGCAAAAAAGCTTGGTGATGTCTGGTCCATATGAACTGAAAGCTCTCCACCTCCAGGGACAGGATATGGA

Ensembl | human accession no.

ENSG00000125538

NCBI accession no.

NM_000576

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... IL1B(3553) , IL1B(3553)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Dong-Dong Zhu et al.
Cardiovascular diabetology, 15, 42-42 (2016-03-06)
Previous studies have shown that high glucose (HG) induced endothelial cell (EC) damage via a phenotypic transition of EC. There is increasing evidence suggesting the role of inflammatory cytokines in mediated HG-induced EC damage. However, little is known about the
Ravi S Keshari et al.
PloS one, 7(10), e48111-e48111 (2012-10-31)
Neutrophils (PMNs) and cytokines have a critical role to play in host defense and systemic inflammatory response syndrome (SIRS). Neutrophil extracellular traps (NETs) have been shown to extracellularly kill pathogens, and inflammatory potential of NETs has been shown. Microbial killing
Dhivya Thiyagarajan et al.
PloS one, 10(6), e0129485-e0129485 (2015-06-13)
We have demonstrated that the renal endonuclease DNaseI is up-regulated in mesangial nephritis while down-regulated during progression of the disease. To determine the basis for these reciprocal DNaseI expression profiles we analyse processes accounting for an early increase in renal
Sambasivan Venkatasubramanian et al.
PLoS pathogens, 11(2), e1004617-e1004617 (2015-02-07)
In this study, we found that a subpopulation of CD4(+)CD25(+) (85% Foxp3(+)) cells from persons with latent tuberculosis infection (LTBI) inhibits growth of M. tuberculosis (M. tb) in human monocyte-derived macrophages (MDMs). A soluble factor, Rho GDP dissociation inhibitor (D4GDI)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico