Saltar al contenido
Merck
Todas las fotos(1)

Key Documents

EHU022711

Sigma-Aldrich

MISSION® esiRNA

targeting human PRICKLE1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAAAGCCTCTTTCAGCCACAGCCCAATGAGATGGATATTCGAGCCAGTGAGCACTGGATATCTGATAACATGGTTAAAAGTAAGACCGAGTTAAAGCAAAATAACCAGAGCCTTGCAAGTAAAAAATACCAGTCTGATATGTACTGGGCACAGTCACAAGATGGACTGGGCGATTCTGCTTATGGCAGCCACCCAGGCCCTGCAAGCAGTAGAAGGCTTCAGGAATTGGAACTGGACCATGGGGCTTCAGGGTATAATCATGATGAAACACAGTGGTATGAAGATTCCCTGGAGTGTCTGTCAGACCTGAAACCAGAGCAAAGTGTTCGGGATTCGATGGATTCTTTGGCATTGTCCAATATCACAGGGGCTTCGGTGGATGGAGAAAACAAGCCAAGGCCATCATTGTATTCTCTGCAAAATTTTGAGGAGATGGAAACAGAAGATTGTGAGAAGATGAGCAATATGGGAACTTTGAACTCTTCCATGCTGCAC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Danielle E Johnson et al.
The Journal of cell biology, 212(6), 677-692 (2016-03-16)
We examined the luminal pH of individual lysosomes using quantitative ratiometric fluorescence microscopy and report an unappreciated heterogeneity: peripheral lysosomes are less acidic than juxtanuclear ones despite their comparable buffering capacity. An increased passive (leak) permeability to protons, together with
Adi Efergan et al.
Journal of immunology (Baltimore, Md. : 1950), 196(3), 1091-1101 (2016-01-08)
Secretory granule (SG) transport is a critical step in regulated exocytosis including degranulation of activated mast cells. The latter process results in the release of multiple inflammatory mediators that play key roles in innate immunity, as well as in allergic
Noopur V Khobrekar et al.
Developmental cell, 53(2), 141-153 (2020-04-11)
Autophagy plays critical roles in neurodegeneration and development, but how this pathway is organized and regulated in neurons remains poorly understood. Here, we find that the dynein adaptor RILP is essential for retrograde transport of neuronal autophagosomes, and surprisingly, their

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico