Saltar al contenido
Merck

EHU017941

Sigma-Aldrich

MISSION® esiRNA

targeting human FPR2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CTTTTGGCTGGTTCCTGTGTAAGTTAATTCACATCGTGGTGGACATCAACCTCTTTGGAAGTGTCTTCTTGATTGGTTTCATTGCACTGGACCGCTGCATTTGTGTCCTGCATCCAGTCTGGGCCCAGAACCACCGCACTGTGAGTCTGGCCATGAAGGTGATCGTCGGACCTTGGATTCTTGCTCTAGTCCTTACCTTGCCAGTTTTCCTCTTTTTGACTACAGTAACTATTCCAAATGGGGACACATACTGTACTTTCAACTTTGCATCCTGGGGTGGCACCCCTGAGGAGAGGCTGAAGGTGGCCATTACCATGCTGACAGCCAGAGGGATTATCCGGTTTGTCATTGGCTTTAGCTTGCCGATGTCCATTGTTGCCATCTGCTATGGGCTCATTGCAGCCAAGATCCACAAAAAGGGCATGATTAAATCCAGCCGTCCCTTACGGGTCCTCACTGCTGTGGTGGCTTCTTTCTTCATCTGTTGGTTTCCCTTTCAACTGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yi Xiang et al.
American journal of cancer research, 6(11), 2599-2610 (2016-12-03)
The G-protein coupled chemoattractant receptor formylpeptide receptor-2 (FPR2 in human, Fpr2 in mice) is expressed by mouse colon epithelial cells and plays a critical role in mediating mucosal homeostasis and inflammatory responses. However, the biological role of FPR2 in human
Liang Zong et al.
Journal of experimental & clinical cancer research : CR, 36(1), 181-181 (2017-12-13)
Pancreatic cancer is a lethal disease in part because of its potential for aggressive invasion and metastasis. Lipoxin A4 (LXA4) is one of the metabolites that is derived from arachidonic acid and that is catalyzed by 15-lipoxygenase (15-LOX), and it
Maayan Pereg et al.
PloS one, 14(6), e0217681-e0217681 (2019-06-07)
The ability to efficiently perform actions immediately following instructions and without prior practice has previously been termed Rapid Instructed Task Learning (RITL). In addition, it was found that instructions are so powerful that they can produce automatic effects, reflected in
Shixun Wang et al.
BioMed research international, 2016, 4819327-4819327 (2016-03-24)
Visfatin has been reported to exert an important role in the development of atherosclerosis. However, the mechanism that regulated the expression of Visfatin has not been elucidated yet. This study aimed to investigate the effect of SAA on the regulation
Mi-Sook Lee et al.
Cellular signalling, 27(7), 1439-1448 (2015-04-12)
Vascular endothelial growth factor-A (VEGF-A) is a master regulator of angiogenesis that controls several angiogenic processes in endothelial cells. However, the detailed mechanisms of VEGF-A responsible for pleiotropic functions and crosstalk with other signaling pathways have not been fully understood.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico