Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU016621

Sigma-Aldrich

MISSION® esiRNA

targeting human CEBPG

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATATCGCAGCAAAACAGCACTCCAGGGGTGAACGGAATTAGTGTTATCCATACCCAGGCACATGCCAGCGGCTTACAGCAGGTTCCTCAGCTGGTGCCTGCTGGCCCTGGGGGAGGAGGCAAAGCTGTGGCTCCCAGCAAGCAGAGCAAAAAGAGTTCGCCCATGGATCGAAACAGTGACGAGTATCGGCAACGCCGAGAGAGGAACAACATGGCTGTGAAAAAGAGCCGGTTGAAAAGCAAGCAGAAAGCACAAGACACACTGCAGAGAGTCAATCAGCTCAAAGAAGAGAATGAACGGTTGGAAGCAAAAATCAAATTGCTGACCAAGGAATTAAGTGTACTCAAAGATTTGTTTCTTGAGCATGCACACAACCTTGCAGACAACGTACAGTCCATTAGCACTGAAAATACGACAGCAGATGGCGACAATGCAGGACAGTAGACCTCACCCTTTCCAGACTTTAGAGCTTGTGGCTTGAATGTTAAAGGTGTGACCACCGACA

Ensembl | human accession no.

ENSG00000153879

NCBI accession no.

NM_001806

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CEBPG(1054) , CEBPG(1054)

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yanhui Yu et al.
DNA and cell biology, 36(3), 212-218 (2017-01-17)
Autophagy is a main defense strategy by which infected host cells can virtually induce the killing of parasite, including Toxoplasma gondii. However, the regulatory mechanisms of autophagy in T. gondii-infected nonhematopoietic cells are still unknown. Emerging evidence indicates that CCAAT/enhancer-binding
Hyun Lim et al.
Phytomedicine : international journal of phytotherapy and phytopharmacology, 76, 153255-153255 (2020-06-20)
Prolonged exposure to the senescence-associated secretory phenotype (SASP) with age leads to chronic low-grade inflammation in neighboring cells and tissues, causing many chronic degenerative diseases. The effects on SASP production of the ethanol extract from Scutellaria radix and 17 isolated
Nirmalya Dasgupta et al.
Biochimica et biophysica acta, 1861(7), 1777-1787 (2017-03-28)
Human polo-like kinase 1 (PLK1), a highly conserved serine/threonine kinase is a key player in several essential cell-cycle events. PLK1 is considered an oncogene and its overexpression often correlates with poor prognosis of cancers, including colorectal cancer (CRC). However, regulation
Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Hong Li et al.
Genetic testing and molecular biomarkers, 23(5), 304-309 (2019-04-11)
Aims: Metastasis is a significant obstacle to curing esophageal squamous cell carcinoma (ESCC). The CCAAT/enhancer binding protein β (C/EBPβ)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico