Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

Ver Toda la documentación

EHU014831

Sigma-Aldrich

MISSION® esiRNA

targeting human BUB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGACCCAGTTGATGGAAAGACTAAAGCCATCTATGCAGCACATGTTTATGAAGTTCTATTCTGCCCACTTATTCCAGAATGGCAGTGTATTAGTAGGAGAGCTCTACAGCTATGGAACATTATTAAATGCCATTAACCTCTATAAAAATACCCCTGAAAAAGTGATGCCTCAAGGTCTTGTCATCTCTTTTGCTATGAGAATGCTTTACATGATTGAGCAAGTGCATGACTGTGAAATCATTCATGGAGACATTAAACCAGACAATTTCATACTTGGAAACGGGCAAGTATTTTTGGAACAGGATGATGAAGATGATTTATCTGCTGGCTTGGCACTGATTGACCTGGGTCAGAGTATAGATATGAAACTTTTTCCAAAAGGAACTATATTCACAGCAAAGTGTGAAACATCTGGTTTTCAGTGTGTTGAGATGCTCAGCAACAAACCATGGAACTACCAGATCGATTACTTTGGGGTTGCTGCAACAGTATATTGCATGCTCTTTGGCAC

Ensembl | nº de acceso humano

ENSG00000169679

Nº de acceso NCBI

NM_004336

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... BUB1(699) , BUB1(699)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QNS
KXR
RPR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mathijs Vleugel et al.
Journal of cell science, 128(16), 2975-2982 (2015-07-08)
Mitotic chromosome segregation is initiated by the anaphase promoting complex/cyclosome (APC/C) and its co-activator CDC20 (forming APC/C(CDC20)). APC/C(CDC20) is inhibited by the spindle assembly checkpoint (SAC) when chromosomes have not attached to spindle microtubules. Unattached kinetochores catalyze the formation of
Yutaka Matsubara et al.
Shock (Augusta, Ga.), 51(3), 364-371 (2018-04-03)
Severe sepsis is critical to health and can result in acute renal failure (ARF). Tissue factor (TF) and thrombomodulin (TM) play key roles in vascular endothelial functions by helping maintain microcirculation in the kidney. Budding uninhibited by benzimidazole-1 (Bub1) plays
Katharina Overlack et al.
Current biology : CB, 27(19), 2915-2927 (2017-09-26)
The spindle assembly checkpoint (SAC) prevents premature sister chromatid separation during mitosis. Phosphorylation of unattached kinetochores by the Mps1 kinase promotes recruitment of SAC machinery that catalyzes assembly of the SAC effector mitotic checkpoint complex (MCC). The SAC protein Bub3
Grégory Eot-Houllier et al.
Nature communications, 9(1), 1888-1888 (2018-05-16)
Sustained spindle tension applied to sister centromeres during mitosis eventually leads to uncoordinated loss of sister chromatid cohesion, a phenomenon known as "cohesion fatigue." We report that Aurora A-dependent phosphorylation of serine 7 of the centromere histone variant CENP-A (p-CENP-AS7)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico