Saltar al contenido
Merck

EHU013881

Sigma-Aldrich

MISSION® esiRNA

targeting human TRIB3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGAAACGAGCTCGAAGTGGGCCCCAGCCCAGACTGCCCCCCTGCCTGTTGCCCCTGAGCCCACCTACTGCTCCAGATCGTGCAACTGCTGTGGCCACTGCCTCCCGTCTTGGGCCCTATGTCCTCCTGGAGCCCGAGGAGGGCGGGCGGGCCTACCAGGCCCTGCACTGCCCTACAGGCACTGAGTATACCTGCAAGGTGTACCCCGTCCAGGAAGCCCTGGCCGTGCTGGAGCCCTATGCGCGGCTGCCCCCGCACAAGCATGTGGCTCGGCCCACTGAGGTCCTGGCTGGTACCCAGCTCCTCTACGCCTTTTTCACTCGGACCCATGGGGACATGCACAGCCTGGTGCGAAGCCGCCACCGTATCCCTGAGCCTGAGGCTGCCGTGCTCTTCCGCCAGATGGCCACCGCCCTGGCGCACTGTCACCAGCACGGTCTGGTCCTGCGTGATCTCAAGCTGTGTCGCTTTGTCTTCGCTGACCGTGAGAGGAAGAAGCTGGTGCTGGAGAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuyi Wang et al.
Biochimica et biophysica acta, 1863(12), 3060-3074 (2017-09-25)
Endoplasmic reticulum (ER) stress has been demonstrated to prompt various cardiovascular risks although the underlying mechanism remains elusive. Protein tyrosine phosphatase-1B (PTP1B) serves as an essential negative regulator for insulin signaling. This study examined the role of PTP1B in ER
Seong-Hoon Yun et al.
Oncotarget, 9(1), 495-511 (2018-02-09)
We previously demonstrated that the quinovose-containing hexaoside stichoposide C (STC) is a more potent anti-leukemic agent than the glucose-containing stichoposide D (STD), and that these substances have different molecular mechanisms of action. In the present study, we investigated the novel
Anna López-Plana et al.
International journal of cancer, 147(4), 1163-1179 (2020-01-17)
Around 40% of newly diagnosed lung cancer patients are Stage IV, where the improvement of survival and reduction of disease-related adverse events is the main goal for oncologists. In this scenario, we present preclinical evidence supporting the use of ABTL0812
Yiteng Meng et al.
Digestive diseases and sciences, 64(8), 2167-2176 (2019-02-15)
The Tec kinase family is involved in acute and chronic inflammatory diseases, but its relationship with severe acute pancreatitis (SAP) remains unclear. To investigate whether Tec tyrosine kinase can be used as a target for severe acute pancreatitis-associated acute lung
Chaoyun Pan et al.
The Journal of clinical investigation, 129(6), 2431-2445 (2019-05-14)
How altered metabolism contributes to chemotherapy resistance in cancer cells remains unclear. Through a metabolism-related kinome RNAi screen, we identified inositol-trisphosphate 3-kinase B (ITPKB) as a critical enzyme that contributes to cisplatin-resistant tumor growth. We demonstrated that inositol 1,3,4,5-tetrakisphosphate (IP4)

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico