Saltar al contenido
Merck

EHU011461

Sigma-Aldrich

MISSION® esiRNA

targeting human BMP4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCAGCCAAACTATGGGCTAGCCATTGAGGTGACTCACCTCCATCAGACTCGGACCCACCAGGGCCAGCATGTCAGGATTAGCCGATCGTTACCTCAAGGGAGTGGGAATTGGGCCCAGCTCCGGCCCCTCCTGGTCACCTTTGGCCATGATGGCCGGGGCCATGCCTTGACCCGACGCCGGAGGGCCAAGCGTAGCCCTAAGCATCACTCACAGCGGGCCAGGAAGAAGAATAAGAACTGCCGGCGCCACTCGCTCTATGTGGACTTCAGCGATGTGGGCTGGAATGACTGGATTGTGGCCCCACCAGGCTACCAGGCCTTCTACTGCCATGGGGACTGCCCCTTTCCACTGGCTGACCACCTCAACTCAACCAACCATGCCATTGTGCAGACCCTGGTCAATTCTGTCAATTCCAGTATCCCCAAAGCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Janice Siu Chong Wong et al.
Experimental eye research, 181, 185-189 (2019-02-06)
Periorbital adipose tissue expansion is a key pathological change in thyroid associated orbitopathy (TAO). Bone morphogenic protein 4 (BMP4) is instrumental in adipogenesis. We compared site-specific BMP4 expression and its effect on adipogenesis using donor-matched adipose tissue-derived stromal cells (ADSC)
Thomas Helbing et al.
Inflammation, 40(6), 1862-1874 (2017-07-30)
Leukocyte recruitment is a fundamental event in the response of the innate immune system to injury. This process is promoted in part by the opening of endothelial cell adherens junctions that allows leukocyte extravasation through gaps between adjacent endothelial cells.
Xiaoqing Zhang et al.
Cell death discovery, 7(1), 51-51 (2021-03-17)
Alzheimer's disease (AD) is a chronic progressive degenerative disease of the nervous system. Its pathogenesis is complex and is related to the abnormal expression of the amyloid β (Aβ), APP, and Tau proteins. Evidence has demonstrated that bone morphogenetic protein
Thomas Helbing et al.
Inflammation, 40(2), 442-453 (2016-12-21)
The endothelium serves as a selective barrier and controls the exchange of nutrients, hormones, and leukocytes between blood and tissues. Molecular mechanisms contributing to the pathogenesis of endothelial barrier dysfunction remain incompletely understood. Accumulating evidence implicates bone morphogenetic protein (BMP)-modulator
Huiming Ju et al.
Molecular medicine reports, 13(3), 2194-2200 (2016-01-20)
MicroRNA-378 (miRNA-378) has been reported to have a crucial role in skeletal muscle differentiation; however, the underlying mechanisms have largely remained to be elucidated. The present study employed high‑throughput RNA sequencing to investigate the transcriptome following transfection of miRNA‑378 mimics

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico