Saltar al contenido
Merck

EHU009781

Sigma-Aldrich

MISSION® esiRNA

targeting human NRIP1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGAAGAGGCTGTCTGATTCTATCATGAATTTAAACGTAAAGAAGGAAGCTTTGCTAGCTGGCATGGTTGACAGTGTGCCTAAAGGCAAACAGGATAGCACATTACTGGCCTCTTTGCTTCAGTCATTCAGCTCTAGGCTGCAGACTGTTGCTCTGTCACAACAAATCAGGCAGAGCCTCAAGGAGCAAGGATATGCCCTCAGTCATGATTCTTTAAAAGTGGAGAAGGATTTAAGGTGCTATGGTGTTGCATCAAGTCACTTAAAAACTTTGTTGAAGAAAAGTAAAGTTAAAGATCAAAAGCCTGATACGAATCTTCCTGATGTGACTAAAAACCTCATCAGAGATAGGTTTGCAGAGTCTCCTCATCATGTTGGACAAAGTGGAACAAAGGTCATGAGTGAACCGTTGTCATGTGCTGCAAGATTACAGGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Hongying Piao et al.
The journal of physiological sciences : JPS, 67(1), 141-150 (2016-03-28)
Estrogen withdrawal following menopause results in an increase of osteoclasts formation and bone resorption, which is one of the most important mechanisms of postmenopausal osteoporosis. Recently, growing evidence has suggested that receptor-interacting protein 140 was implicated in estrogen-regulated metabolic disease
J You et al.
Acta physiologica (Oxford, England), 220(1), 58-71 (2016-09-11)
The transcriptional cofactor receptor-interacting protein 140 (RIP140) is known as a deleterious regulator of cardiac mitochondrial function and energy metabolic homeostasis. This study revealed that RIP140 repressed Sirtuin 3 (SIRT3), a mitochondrial deacetylase that plays an important role in regulating
X F Ni et al.
Neoplasma, 65(6), 881-887 (2018-06-27)
Nuclear receptor interacting protein (NRIP1), also known as RIP140, is a transcriptional co-regulator required for the maintenance of energy homeostasis and ovulation. Although several studies have identified roles for NRIP1 in various cell processes, the biological functions of NRIP1 in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico