Saltar al contenido
Merck

EHU008751

Sigma-Aldrich

MISSION® esiRNA

targeting human EPAS1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCCAGGTGAAAGTCTACAACAACTGCCCTCCTCACAATAGTCTGTGTGGCTACAAGGAGCCCCTGCTGTCCTGCCTCATCATCATGTGTGAACCAATCCAGCACCCATCCCACATGGACATCCCCCTGGATAGCAAGACCTTCCTGAGCCGCCACAGCATGGACATGAAGTTCACCTACTGTGATGACAGAATCACAGAACTGATTGGTTACCACCCTGAGGAGCTGCTTGGCCGCTCAGCCTATGAATTCTACCATGCGCTAGACTCCGAGAACATGACCAAGAGTCACCAGAACTTGTGCACCAAGGGTCAGGTAGTAAGTGGCCAGTACCGGATGCTCGCAAAGCATGGGGGCTACGTGTGGCTGGAGACCCAGGGGACGGTCATCTACAACCCTCGCAACCTGCAGCCCCAGTGCATCATGTGTGTCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Seungyeul Yoo et al.
PLoS genetics, 11(1), e1004898-e1004898 (2015-01-09)
Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA
Olga Roche et al.
Nucleic acids research, 44(19), 9315-9330 (2016-11-02)
A wide range of diseases course with an unbalance between the consumption of oxygen by tissues and its supply. This situation triggers a transcriptional response, mediated by the hypoxia inducible factors (HIFs), that aims to restore oxygen homeostasis. Little is
Shirley Dehn et al.
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3639-3649 (2016-09-28)
Hypoxia-inducible factor (HIF)-α isoforms regulate key macrophage (MΦ) functions during ischemic inflammation. HIF-2α drives proinflammatory cytokine production; however, the requirements for HIF-2α during other key MΦ functions, including phagocytosis, are unknown. In contrast to HIF-1α, HIF-2α was not required for
Maria Lucibello et al.
Oncotarget, 6(7), 5275-5291 (2015-03-18)
Upregulation of Translationally Controlled Tumor Protein (TCTP) is associated with poorly differentiated aggressive tumors, including breast cancer, but the underlying mechanism(s) are still debated. Here, we show that in breast cancer cell lines TCTP is primarily localized in the nucleus

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico