Saltar al contenido
Merck

EHU001951

Sigma-Aldrich

MISSION® esiRNA

targeting human REL

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCCATCTCAAGTGGATTGTCACATCATGCCTCAATGGCACCTCTGCCTTCTTCAAGCTGGTCATCAGTGGCCCACCCCACCCCACGCTCAGGCAATACAAACCCACTGAGTAGTTTTTCAACAAGGACACTTCCTTCTAATTCGCAAGGTATCCCACCATTCCTGAGAATACCTGTTGGGAATGATTTAAATGCTTCTAATGCTTGCATTTACAACAATGCCGATGACATAGTCGGAATGGAAGCGTCATCCATGCCATCAGCAGATTTATATGGTATTTCTGATCCCAACATGCTGTCTAATTGTTCTGTGAATATGATGACAACCAGCAGTGACAGCATGGGAGAGACTGATAATCCAAGACTTCTGAGCATGAATCTTGAAAACCCCTCATGTAATTCAGTGTTAGACCCAAGAGACTTGAGACAGCTCCATCAGATGTCCTCTTCCAGTATGTCAGCAGGCGCCAATTCCAATACTACTGTTTTTGTTTCACAATCAGATGCATTTGAGGGATCTGACTTCAGTTGTGCAGATAACAGCATGATAAATGAGTCGGGACCATCAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaodong Lai et al.
Oncology reports, 36(6), 3651-3656 (2016-10-26)
miR‑574‑5p has been reported involved in the pathogenesis of numerous human malignancies such as colorectal and lung cancer. In this study, we aimed to explore the roles of REL and miR‑574 in the recurrence of prostate cancer (PCa) and to identify
Seyedeh Momeneh Mohammadi et al.
Leukemia research, 61, 53-61 (2017-09-12)
The c-Rel transcription factor is a unique member of the NF-kB family that has a role in apoptosis, proliferation and cell survival. Overexpression of c-Rel is detected in many human B cell tumors, including B-cell leukemia and several cancers. The
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico