Saltar al contenido
Merck

EHU001891

Sigma-Aldrich

MISSION® esiRNA

targeting human INCENP

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CACCTGCTGGAGCTATGTGACCAGAAGCTCATGGAGTTTCTCTGCAACATGGATAATAAGGACTTGGTGTGGCTTGAGGAAATCCAAGAGGAGGCCGAGCGCATGTTCACCAGAGAATTCAGCAAAGAGCCAGAGCTGATGCCCAAAACACCTTCTCAGAAGAACCGACGGAAGAAGAGACGGATTTCTTATGTTCAGGATGAAAACAGAGATCCCATCAGGAGAAGGTTATCCCGCAGAAAGTCTCGGAGCAGCCAGCTGAGCTCCCGACGCCTCCGCAGCAAGGACAGTGTAGAGAAGCTGGCTACAGTGGTCGGGGAGAACGGCTCCGTCCTGCGGCGTGTGACCCGTGCTGCGGCTGCAGCTGCCGCGGCTACCATGGCATTGGCTGCACCTTCTTCACCCACCCCTGAGTCTCCCACGATGCTGACTAAGAAGCCCG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Andrius Serva et al.
PloS one, 7(12), e52555-e52555 (2013-01-04)
miRNA cluster miR-17-92 is known as oncomir-1 due to its potent oncogenic function. miR-17-92 is a polycistronic cluster that encodes 6 miRNAs, and can both facilitate and inhibit cell proliferation. Known targets of miRNAs encoded by this cluster are largely
Keith F DeLuca et al.
The Journal of cell biology, 217(1), 163-177 (2017-12-01)
Precise regulation of kinetochore-microtubule attachments is essential for successful chromosome segregation. Central to this regulation is Aurora B kinase, which phosphorylates kinetochore substrates to promote microtubule turnover. A critical target of Aurora B is the N-terminal "tail" domain of Hec1
Ming Sun et al.
Cancer research, 79(19), 4937-4950 (2019-08-17)
Chromosomal passenger complex (CPC) has been demonstrated to be a potential target of cancer therapy by inhibiting Aurora B or survivin in different types of cancer including neuroblastoma. However, chemical inhibition of either Aurora B or survivin does not target

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico