Skip to Content
Merck
All Photos(1)

Key Documents

EHU140771

Sigma-Aldrich

MISSION® esiRNA

targeting human ANO1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GATGCCGACGAAGAAGATGTACCACATTAATGAGACCCGTGGCCTCCTGAAAAAAATCAACTCTGTGCTCCAGAAAATCACAGATCCCATCCAGCCCAAAGTGGCTGAGCACAGGCCCCAGACCATGAAGAGACTCTCCTATCCCTTCTCCCGGGAGAAGCAGCATCTATTTGACTTGTCTGATAAGGATTCCTTTTTCGACAGCAAAACCCGGAGCACGATTGTCTATGAGATCTTGAAGAGAACGACGTGTACAAAGGCCAAGTACAGCATGGGCATCACGAGCCTGCTGGCCAATGGTGTGTACGCGGCTGCATACCCACTGCACGATGGAGACTACAACGGTGAAAACGTCGAGTTCAACGACAGAAAACTCCTGTACGAAGAGTGGGCACGCTATGGAGTTTTCTATAAGTACCAGCCCATCGACC

Ensembl | human accession no.

ENSG00000131620

NCBI accession no.

NM_018043

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... ANO1(55107) , ANO1(55107)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Chuantao Zhang et al.
International journal of clinical oncology, 25(6), 1145-1154 (2020-04-03)
Increase of the Ca2+-activated chloride channel TMEM16A is contribute to tumorigenesis. However, the expression level of TMEM16A and its underlying molecular mechanism for TMEM16Apromotingliver carcinogenesis is remains unknown. In the present study, the expression of TMEM16A in hepatocellular carcinoma (HCC)
Huan Lian et al.
Biochemical and biophysical research communications, 487(2), 201-208 (2017-04-11)
Diabetic nephropathy (DN) is one of the most common microvascular complication of diabetes mellitus (DM) as well as the main reason resulting in chronic renal failure. Transmembrane protein 16A (TMEM16A) plays an important role in multiple physiological actions. Here we
Hui Wang et al.
Cancer letters, 455, 48-59 (2019-05-03)
The Ca2+-activated chloride channel TMEM16A (anoctamin 1) is overexpressed in breast cancer. It remains unclear how TMEM16A overexpression plays a role in carcinogenesis in breast cancer. In this study, we found that high TMEM16A expression in combination with high EGFR
Shenbin Liu et al.
British journal of pharmacology, 173(7), 1208-1218 (2016-01-13)
TMEM16A, also known as anoctamin 1 channel, is a member of the Ca(2+)-activated chloride channels family and serves as a heat sensor in the primary nociceptors. Eact is a recently discovered small molecule activator of the TMEM16A channel. Here, we
Fanning Zeng et al.
PloS one, 7(10), e47686-e47686 (2012-11-08)
GPR39 is a GPCR implicated as a regulator of gastrointestinal motility, although the mechanism remains elusive. Here, we report that GPR39 is expressed by a specific cell population cultured from mouse small intestine muscle layers, which was subsequently identified as
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service