Skip to Content
Merck
All Photos(1)

Key Documents

EHU080431

Sigma-Aldrich

MISSION® esiRNA

targeting human NCL

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGGCGATCTATTTCCCTGTACTATACTGGAGAGAAAGGTCAAAATCAAGACTATAGAGGTGGAAAGAATAGCACTTGGAGTGGTGAATCAAAAACTCTGGTTTTAAGCAACCTCTCCTACAGTGCAACAGAAGAAACTCTTCAGGAAGTATTTGAGAAAGCAACTTTTATCAAAGTACCCCAGAACCAAAATGGCAAATCTAAAGGGTATGCATTTATAGAGTTTGCTTCATTCGAAGACGCTAAAGAAGCTTTAAATTCCTGTAATAAAAGGGAAATTGAGGGCAGAGCAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCCAGAAGCCAGCCATCCAAAACTCTGTTTGTCAAAGGCCTGTCTGAGGATACCACTGAAGAGACATTAAAGGAGTCATTTGACGGCTCCGTTCGGGCAAGGATAGTTA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Application

MISSION® esiRNA has been used for transfection of cells to target nucleolin.

Biochem/physiol Actions

NCL (nucleolin) is ribonucleoprotein, mainly involved in ribosomal biogenesis. Additionally, it is linked with cell differentiation and proliferation, stress-conditioned responses and cellular shuttling. This gene is upregulated in cancer cells. In cancer cells, it is associated with progression and is mainly present on the membrane of cancer cells. On the membrane, it binds to tumor promoting proteins.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zoi Diamantopoulou et al.
Oncotarget, 8(52), 90108-90122 (2017-11-23)
In this study, a novel anticancer reagent based on polyplexes nanoparticles was developed. These nanoparticles are obtained by mixing negatively charged polyelectrolytes with the antitumour cationically-charged pseudopeptide N6L. Using two
Quantitative Cell Cycle Analysis Based on an Endogenous All-in-One Reporter for Cell Tracking and Classification.
Zerjatke T
Cell Reports, 19, 1953-1953 (2017)
Fengfei Wang et al.
Journal of the American Chemical Society, 141(8), 3613-3622 (2019-01-29)
The aim of this study is to illuminate a novel therapeutic approach by identifying a functional binding target of salinomycin, an emerging anticancer stem cell (CSC) agent, and to help dissect the underlying action mechanisms. By utilizing integrated strategies, we
Nucleolin-binding by ErbB2 enhances tumorigenicity of ErbB2-positive breast cancer.
Wolfson E
Oncotarget, 7, 65320-65320 (2016)
Nucleolin antagonist triggers autophagic cell death in human glioblastoma primary cells and decreased in vivo tumor growth in orthotopic brain tumor model.
Benedetti E
Oncotarget, 6, 42091-42091 (2015)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service