Skip to Content
Merck
All Photos(1)

Key Documents

EMU014921

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Parp1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGCCATCAAGAATGAAGGAAAGAGAAAAGGTGACGAGGTGGATGGAACAGATGAAGTGGCCAAAAAGAAATCTAAGAAAGGGAAGGACAAGGATAGTAGTAAGCTGGAGAAGGCCCTCAAGGCTCAGAATGAGCTGATCTGGAATATCAAAGACGAGCTGAAGAAAGCGTGTTCCACCAACGACCTGAAGGAGCTGCTCATCTTCAACCAGCAGCAGGTGCCGTCAGGAGAGTCAGCGATCTTGGACAGAGTTGCTGACGGCATGGCGTTTGGGGCCCTTCTGCCCTGCAAGGAGTGTTCAGGCCAGCTGGTCTTTAAGAGCGACGCTTATTACTGTACTGGGGATGTCACTGCCTGGACCAAGTGCATGGTCAAGACACAGAATCCTAGCCGAAAGGAATGGGTAACTCCAAAGGAATTCCGAGAAA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

J R Tejedo et al.
Cell death & disease, 1, e80-e80 (2011-03-04)
Nitric oxide (NO) is an intracellular messenger in several cell systems, but its contribution to embryonic stem cell (ESC) biology has not been characterized. Exposure of ESCs to low concentrations (2-20 μM) of the NO donor diethylenetriamine NO adduct confers protection
Hui Peng et al.
PloS one, 10(5), e0125318-e0125318 (2015-05-21)
Microsomal epoxide hydrolase (mEH) is a bifunctional protein that plays a central role in the metabolism of numerous xenobiotics as well as mediating the sodium-dependent transport of bile acids into hepatocytes. These compounds are involved in cholesterol homeostasis, lipid digestion
Hyeon-Jun Shin et al.
Scientific reports, 5, 15798-15798 (2015-11-03)
Necrosis, unregulated cell death, is characterized by plasma membrane rupture as well as nuclear and cellular swelling. However, it has recently been reported that necrosis is a regulated form of cell death mediated by poly-(ADP-ribose) polymerase 1 (PARP1). PARP1 is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service