Skip to Content
Merck
All Photos(1)

Key Documents

EHU069741

Sigma-Aldrich

MISSION® esiRNA

targeting human POSTN

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AATCATCCATGGGAACCAGATTGCAACAAATGGTGTTGTCCATGTCATTGACCGTGTGCTTACACAAATTGGTACCTCAATTCAAGACTTCATTGAAGCAGAAGATGACCTTTCATCTTTTAGAGCAGCTGCCATCACATCGGACATATTGGAGGCCCTTGGAAGAGACGGTCACTTCACACTCTTTGCTCCCACCAATGAGGCTTTTGAGAAACTTCCACGAGGTGTCCTAGAAAGGATCATGGGAGACAAAGTGGCTTCCGAAGCTCTTATGAAGTACCACATCTTAAATACTCTCCAGTGTTCTGAGTCTATTATGGGAGGAGCAGTCTTTGAGACGCTGGAAGGAAATACAATTGAGATAGGATGTGACGGTGACAGTATAACAGTAAATGGAATCAAAATGGTGAACAAAAAGGATATTGTGACAAATAATGGTGTGATCCATTTGATTGA

Ensembl | human accession no.

ENSG00000133110

NCBI accession no.

NM_006475

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... POSTN(10631) , POSTN(10631)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

A Tomaru et al.
Gene therapy, 24(11), 706-716 (2017-08-19)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease with a median survival of 3-4 years after diagnosis. It is the most frequent form of a group of interstitial pneumonias of unknown etiology. Current available therapies prevent deterioration of lung function
Yujin Liu et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 88, 342-348 (2017-01-26)
Hypoxia has been suggested to induce chemoresistance in tumor cells. In this study, we aimed to test the hypothesis that hypoxia-inducible factor-1alpha (HIF-1α)/periostin axis might promote arsenic trioxide resistance in hepatocellular carcinoma (HCC) cells under hypoxia. HCC cells were exposed
Jae Eun Um et al.
Scientific reports, 7(1), 8490-8490 (2017-08-19)
Diabetic nephropathy, the major cause of chronic kidney disease, is associated with progressive renal fibrosis. Recently, accumulation of periostin, an extracellular matrix protein, was shown to augment renal fibrosis. Aptamers have higher binding affinities without developing the common side effects
Xiting Han et al.
Journal of cellular physiology, 234(8), 14170-14180 (2019-01-12)
The human cervical cancer (CC) has been identified as one of the most common tumors in women, and the molecular regulation in CC still remains unclear. The dysregulation of periostin has been found in a variety of cancers, but whether
Xiaofan Guo et al.
Oncotarget, 7(49), 80521-80542 (2016-09-08)
Tumor-associated macrophages (TAMs) are enriched in gliomas and help create a tumor-immunosuppressive microenvironment. A distinct M2-skewed type of macrophages makes up the majority of glioma TAMs, and these cells exhibit pro-tumor functions. Gliomas contain large hypoxic areas, and the presence
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service