Skip to Content
Merck
All Photos(1)

Key Documents

EHU044171

Sigma-Aldrich

MISSION® esiRNA

targeting human MAPK1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCGCTTCAGACATGAGAACATCATTGGAATCAATGACATTATTCGAGCACCAACCATCGAGCAAATGAAAGATGTATATATAGTACAGGACCTCATGGAAACAGATCTTTACAAGCTCTTGAAGACACAACACCTCAGCAATGACCATATCTGCTATTTTCTCTACCAGATCCTCAGAGGGTTAAAATATATCCATTCAGCTAACGTTCTGCACCGTGACCTCAAGCCTTCCAACCTGCTGCTCAACACCACCTGTGATCTCAAGATCTGTGACTTTGGCCTGGCCCGTGTTGCAGATCCAGACCATGATCACACAGGGTTCCTGACAGAATATGTGGCCACACGTTGGTACAGGGCTCCAGAAATTATGTTGAATTCCAAGGGCTACACCAAGTCCATTGATATTTGGTCTGTAGGCTGCATTCTGGCAGAAATGCTTTCTAACAGGCCCATCTTTCCA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jian Zhang et al.
Experimental & molecular medicine, 49(9), e379-e379 (2017-09-25)
The objective of this study was to investigate the regulatory effects of TGF-β1 on CCL3/4 expression and inflammation-related pain during intervertebral disc degeneration (IVDD). TGF-β1 and CCL3/4 expression patterns in different degenerative human nucleus pulposus (NP) tissues were measured by
Li-Li Xu et al.
Oxidative medicine and cellular longevity, 2018, 3271617-3271617 (2018-06-12)
Ulcerative colitis (UC) is a common inflammatory bowel disease that can destroy the integrity of the colon and increase the risk of colorectal cancer. Oxidative stress is one of the critical pathogenic factors for UC, further impairing the entire affected
Susanne Ulm et al.
Journal of molecular and cellular cardiology, 72, 104-116 (2014-03-19)
Mitogen-activated protein kinases (MAPKs) are involved in the regulation of cardiac hypertrophy and myocyte survival. Extracellular signal regulated protein kinase 1 and 2 (ERK1/2) are key components in the MAPK signaling pathways. Dysfunction of ERK1/2 in congenital heart diseases (Noonan
Bishuang Cai et al.
Science signaling, 11(549) (2018-09-27)
Inflammation resolution counterbalances excessive inflammation and restores tissue homeostasis after injury. Failure of resolution contributes to the pathology of numerous chronic inflammatory diseases. Resolution is mediated by endogenous specialized proresolving mediators (SPMs), which are derived from long-chain fatty acids by
Vijay G Ramakrishnan et al.
Haematologica, 104(10), 2061-2074 (2019-03-09)
Despite recent advances in the treatment of multiple myeloma, patients with this disease still inevitably relapse and become refractory to existing therapies. Mutations in K-RAS, N-RAS and B-RAF are common in multiple myeloma, affecting 50% of patients at diagnosis and

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service