Skip to Content
Merck
All Photos(1)

Key Documents

EHU025391

Sigma-Aldrich

MISSION® esiRNA

targeting human CAPN2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTGTCAACTCCACCAAGTCATCGTTGCTCGGTTTGCAGATGACCAGCTCATCATCGATTTTGATAATTTTGTTCGGTGTTTGGTTCGGCTGGAAACGCTATTCAAGATATTTAAGCAGCTGGATCCCGAGAATACTGGAACAATAGAGCTCGACCTTATCTCTTGGCTCTGTTTCTCAGTACTTTGAAGTTATAACTAATCTGCCTGAAGACTTCTCATGATGGAAAATCAGCCAAGGACTAAGCTTCCATAGAAATACACTTTGTATCTGGACCTCAAAATTATGGGAACATTTACTTAAACGGATGATCATAGCTGAAAATAATGATACTGTCAATTTGAGATAGCAGAAGTTTCACACATCAAAGTAAAAGATTTGCATATCATTATACTAAATGCAAATGAGTCGCTTAACCC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this
Sheng Wang et al.
The Journal of biological chemistry, 292(20), 8291-8303 (2017-04-01)
Capsaicin is an ingredient in spicy peppers that produces burning pain by activating transient receptor potential vanilloid 1 (TRPV1), a Ca2+-permeable ion channel in nociceptors. Capsaicin has also been used as an analgesic, and its topical administration is approved for

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service